Extended spectrum β-lactamases and class C β-lactamases gene frequency in <i>Pseudomonas aeruginosa</i> isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study

Dina N. Abdelrahman; Aya A. Taha; Mazar M. Dafaallah; Alaa Abdelgafoor Mohammed; Abdel Rahim M. El Hussein; Ahmed I. Hashim; Yousif F. Hamedelnil; Hisham N. Altayb

doi:10.12688/f1000research.24818.1

Home Browse Extended spectrum β-lactamases and class C β-lactamases gene frequency...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Extended spectrum β-lactamases and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study

[version 1; peer review: 1 not approved]

Dina N. Abdelrahman ^1,2, Aya A. Taha², Mazar M. Dafaallah², [...] Alaa Abdelgafoor Mohammed³, Abdel Rahim M. El Hussein¹, Ahmed I. Hashim², Yousif F. Hamedelnil², Hisham N. Altayb⁴

Dina N. Abdelrahman ^1,2, Aya A. Taha², [...] Mazar M. Dafaallah², Alaa Abdelgafoor Mohammed³, Abdel Rahim M. El Hussein¹, Ahmed I. Hashim², Yousif F. Hamedelnil², Hisham N. Altayb⁴

PUBLISHED 27 Jul 2020

Author details Author details

¹ Department of Virology, Central Laboratory, Khartoum, Sudan
² Department of Microbiology, College of Medical Laboratory Sciences, College of medical laboratory sciences, Sudan University of Science and Technology, Khartoum, Sudan
³ Department of Pharmaceutical Biotechnology, College of Pharmacy, College of Pharmacy, Ahfad University for women, Omdurman, Khartoum, Sudan
⁴ Biochemistry Department, Faculty of Sciences, Faculty of Sciences - King Abdulaziz University, Jeddah, Saudi Arabia

Dina N. Abdelrahman
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation

Aya A. Taha
Roles: Investigation, Methodology, Resources, Validation, Visualization

Mazar M. Dafaallah
Roles: Investigation, Methodology, Resources, Visualization

Alaa Abdelgafoor Mohammed
Roles: Investigation, Visualization

Abdel Rahim M. El Hussein
Roles: Writing – Review & Editing

Ahmed I. Hashim
Roles: Investigation, Methodology, Software, Writing – Review & Editing

Yousif F. Hamedelnil
Roles: Conceptualization, Investigation, Methodology, Supervision

Hisham N. Altayb
Roles: Conceptualization, Data Curation, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Pathogens gateway.

Abstract

Background: Pseudomonas aeruginosa is a pathogenic bacterium, causing nosocomial infections with intrinsic and acquired resistance mechanisms to a large group of antibiotics, including β-lactams. This study aimed to determine the susceptibility pattern to selected antibiotics and to index the first reported β-lactamases gene (extended spectrum β-lactamases (ESBLs) genes and class C β-lactamases genes) frequency in Ps. aeruginosa in Khartoum State, Sudan.
Methods: 121 Ps. aeruginosa clinical isolates from various clinical specimens were used in this cross-sectional study conducted in Khartoum State. A total of 80 isolates were confirmed as Ps. aeruginosa through conventional identification methods and species-specific primers (the remaining 40 isolates were other bacterial species). The susceptibility pattern of the confirmed isolates to selected antibiotics was done following the Kirby Bauer disk diffusion method. Multiplex PCR was used for detection of seven β-lactamase genes (bla_TEM, bla_SHV, bla_CTXM-1, bla_VEB, bla_OXA-1, bla_AmpC and bla_DHA).
Results: Of the 80 confirmed Ps. aeruginosa isolates, 8 (10%) were resistant to Imipenem while all isolates were resistant to Amoxicillin and Amoxyclav (100%). A total of 43 (54%) Ps. aeruginosa isolates were positive for ESBLs genes, while 27 (34%) were positive for class C β-lactamases, and 20 (25%) were positive for both classes. Frequency of ESBLs genes was as follows: bla_TEM, 19 (44.2%); bla_SHV, 16 (37.2%); bla_CTX-M1, 10 (23.3%); bla_VEB, 14 (32.6%); and bla_OXA-1, 7 (16.3%). Occurrence of class C β-lactamases genes was bla_AmpC 22 (81.5%) and bla_DHA 8 (29.6%). In total, 3 (11.1%) isolates were positive for both bla_AmpCand bla_DHAgenes.
Conclusion: Ps. aeruginosa isolates showed a high rate of β-lactamases production, with co-resistance to other antibiotic classes. The lowest resistance rate of Ps. aeruginosa was to Imipenem followed by Gentamicin and Ciprofloxacin. No statistically significant relationship between production of β-lactamases in Ps. aeruginosa and resistance to third generation cephalosporins was found.

Keywords

ESBLs, class C β-lactamase, Polymerase Chain Reaction, Ps. aeruginosa, pyocyanin pigment, Khartoum-Sudan.

Corresponding author: Dina N. Abdelrahman

Competing interests: No competing interests were disclosed.

Grant information: The author(s) declared that no grants were involved in supporting this work.

Copyright: © 2020 Abdelrahman DN et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Abdelrahman DN, Taha AA, Dafaallah MM et al. Extended spectrum β-lactamases and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study [version 1; peer review: 1 not approved]. F1000Research 2020, 9:774 (https://doi.org/10.12688/f1000research.24818.1) First published: 27 Jul 2020, 9:774 (https://doi.org/10.12688/f1000research.24818.1) Latest published: 01 Apr 2021, 9:774 (https://doi.org/10.12688/f1000research.24818.3)

Introduction

Pseudomonas aeruginosa is one of the leading causes of nosocomial infections worldwide with high mortality rates, particularly among immunocompromised patients¹. Ps. aeruginosa infections are difficult to treat, due to its extraordinary antimicrobial resistance to all available classes of antimicrobial agents², including β-lactams, aminoglycosides and fluoroquinolones³. Resistance to β-lactams occurs by different mechanisms, including bla_AmpC overexpression due to genetic mutations, mutant gene acquisition, overproduction of efflux system, or low permeability³. β-lactamases refer to enzymes that hydrolyze the amide bond of the β-lactam ring leading to drug inactivation and therapy failure⁴. β-lactamases are classified molecularly into four groups: class A (extended spectrum β-lactamases (ESBLs)), class B (metallo-β-lactamases), class C (cephalosporinases), and class D (oxacillinases)⁵.

ESBLs are enzymes that extend their hydrolyzing ability to hydrolyze broad spectrum cephalosporins⁶ and they also confer resistance to penicillins and narrow spectrum cephalosporins³. ESBLs are inhibited by β-lactamase inhibitors, such as clavulanic acid⁷. β-lactamases are transformed to ESBLs usually after point mutations in the β-lactamases gene. These mutations alter the substrate specificity because of changes in the amino acid sequences near the enzyme active site⁵. ESBLs producing Ps. aeruginosa have been reported worldwide in different countries^8–17.

AmpC β-lactamases are class C cephalosporinases that mediate bacterial resistance to cephalosporins and cephamycins. They also exhibit low rates of monobactam, cefepime and carbapenem hydrolysis¹⁸ and usually resist the inhibition by clavulanic acid⁴. Normally, AmpC is a chromosomal β-lactamase gene that is regulated by ampR gene and expressed constantly. Point mutations of ampR gene in Enterobacter cloacae activate AmpC that mediate resistance to β-lactams¹⁹. In Ps. aeruginosa over expressed AmpC β-lactamase mediate the resistance to broad spectrum cephalosporins³. AmpC β-lactamase in Ps. aeruginosa has also been reported in different countries around the world^20–27.

The exact frequency of β-lactamase producing Ps. aeruginosa in Khartoum State, Sudan is unknown; therefore, the aim of this study was to determine the susceptibility pattern to selected antibiotics and to determine the frequency of β-lactamases producing Ps. areuginosa isolates collected in Khartoum State hospitals.

Methods

Study design

This is a cross-sectional study conducted between February 2017 and October 2017. Ethical approval for the study was obtained from the ethical committee of the College of Medical Laboratory Science, Sudan University of Science and Technology (SUST) (ethical meeting no, SUST/DSR/1EC/EA2/2017; data, 07^th January 2017). Written informed consent from participants was waived by the same ethical committee as the study only used previously collected human bio-specimens with limited participant data.

Collection and identification of bacterial strains

A total of 121 clinical isolates, which initially identified as Ps. aeruginosa and bacteria other than Ps. aeruginosa was excluded. Selected isolates were obtained from Soba Teaching Hospital, Elribat University Hospital, National Laboratory for Public Health, Ear Nose Throat Hospital, and Military Hospital in Khartoum State. When there was a positive confirmation of Ps. aeruginosa, the study supervisor went and collected the sample from the hospital. The samples were collected from patients suffering from urinary tract infections, respiratory tract infections, blood infections, and wound and ear infections. Data pertaining to the site of infection was collected from hospital records. The bacteria were preserved in 20% glycerol and peptone water and stored at -20°C

Phenotypic identity of the isolates was confirmed through conventional bacterial identification methods, such as Gram stain, oxidase test, and reactions in media containing sugars, such as Kligler Iron Agar, urease test and, citrate test. Pigment production was assessed using Muller Hinton agar, and then phenotypic identity confirmed by genotypic characterization using multiplex PCR, as previously described¹.

Antimicrobial susceptibility testing

Muller Hinton medium (HiMedia, India) was prepared and sterilized as instructed by the manufacturer. Antimicrobial susceptibility testing was performed following the modified Kirby-Bauer disc diffusion method¹ and the results interpreted according to Clinical Laboratory Standards Institute guidelines (CLSI, 2007). The following antimicrobial discs (HiMedia, India) were used for sensitivity testing: Amoxicillin (25 µg), Cefotaxime (30 µg), Amoxicillin-Clavulanic acid (30 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Chloramphenicol (30 µg) and Imipenem (10 µg). Ps. aeruginosa ATCC 27853 was used as quality control strain to control the performance of the test and ensure that the test is properly performed.

Phenotypic identity of the isolates was confirmed through conventional bacterial identification methods such as Gram stain, oxidase test, reactions in media containing sugars such as Kligler Iron Agar, urease test and citrate test.

Genotypic analysis of bacterial isolates

Genomic DNA was extracted by simple boiling method¹⁸. The extracted DNA was used as a template for amplification of target genes using multiplex PCR using TECHNE TC-312 (UK) thermocycler. Firstly, oprI and oprL primers (Table 1) (Macrogen, Korea) were used to confirm the identification of Ps. aeruginosa. Seven primer pairs (Table 1) (Macrogen, Korea) were used for detection of ESBLs genes (bla_TEM, bla_SHV, bla_CTXM-1, bla_VEB, bla_OXA-1) and class C genes (bla_AmpC and bla_DHA). The oprI and oprL reaction was carried out with the following cycling conditions: denaturation at 95°C for 5 min; 33 cycles of denaturation at 95°C for 30 secs, annealing at 58°C for 30 sec and extension at 72°C for 30 secs, and final extension at 72°C for 5 min²⁸.

Table 1. Primer sequences.

Target gene	Primers	Sequences (5'-3')	Product size (bp)	References
oprI	F	ATGAACAACGTTCTGAAATTC	250	29
	R	CTTGCGGCTGGCTTTTTCCAG
oprL	F	ATGGAAATGCTGAAATTCGGC	500	29
	R	CTTCTTCAGCTCGACGCGACG
TEM	F	ATGAGTATTCAACATTTCCGTG	861	30
	R	TTACCAATGCTTAATCAGTGAG
SHV	F	TTTATGGCGTTACCTTTGACC	1050	30
	R	ATTTGTCGCTCTTTACTCGC
CTXM-1	F	GACGATGTCACTGGCTGAGC	499	31
	R	AGCCGCCGACGCTAATACA
AmpC	F	ATCAAAACTGGCAGCCG	550	32
	R	GAGCCCGTTTTATGGACCCA
DHA	F	AACTTTCACAGGTGTGCTGGGT	405	33
	R	CCGTACGCATACTGGCTTTGC
VEB	F	CATTCCCGATGCAAAGCGT	648	34
	R	CGAAGTTTCTTTGGACTCTG
OXA-1	F	GGCACCAGATTCAACTTTCAAG	564	35
	R	GACCCCAAGTTTCCTGTAAGTG

β-lactamases detection was done in two batches; the first batch was used for detection of bla_TEM, bla_SHV, bla_CTXM-1, bla_AmpC and bla_DHA, while the second batch was used for detection of bla_VEB and bla_OXA-1 genes. The first batch detection was done in 20 µl of final reaction mixture using Maxime PCR Premix kits (iNtRON Biotechnology, Korea), containing 13 µl of double distilled water (DDW), 0.3µl of each five forward and 0.3 µl of each five reverse primers (1.5 µl), 2 µl of Dimethyl sulfoxide (DMSO) and 2 µl of template DNA.

Amplification of the second batch was done in 20µl using Maxime PCR Premix kits (iNtRON Biotechnology, Korea), containing 14.4 µl of DDW, 0.4 µl of each two forward and 0.4 µl of each two reverse primers (0.8 µl), 2 µl of DMSO and 2 µl of template DNA. Cycling conditions for both amplification reactions were as follows: initial denaturation at 94°C for 2 minutes, then 35 cycles of denaturation at 94°C for 30 secs, annealing at 54°C for 30 secs and extension at 72°C for 50 secs, and final extension at 72° for 5 minutes.

Amplified products were analyzed by electrophoreses at 80 volts for 20 minutes on 1.5% agarose gel containing ethidium bromide and then visualized using UV transilluminator (Uvitec–UK) with 50bp or 100bp molecular DNA ladder (iNtRON Biotechnology, Korea).

Data analysis

Statistical analysis of the data was performed using chi-square test (level of significance was 0.05) with SPSS software version 20 and GraphPad prism 5 demo.

Results

From 121 clinical isolates collected from different hospitals in Khartoum State, only 80 (66%) were confirmed as Ps. aeruginosa through conventional methods and species-specific primers; the remaining 41 (34%) isolates were considered as other Gram-negative rod bacteria. The distribution of clinical isolates according to site of infection was as follows: urine, 34 (42%); wound swab, 24 (30%); ear swab, 8 (10%); sputum, 8 (10%); and blood, 6 (7.5%).

The results of antimicrobial susceptibility test for selected antibiotics are presented in Table 2.

Table 2. Antimicrobial susceptibility pattern of Pseudomonas aeruginosa (n=80).

Antimicrobial agent	Susceptible isolates	Resistant isolates
Ciprofloxacin	57 (71.2)	23 (28.8)
Gentamicin	61 (76.2)	19 (23.8)
Imipenem	72 (90)	8 (10.0)
Chloramphenicol	9 (11.2)	71 (88.8)
Amoxyclav	0	80 (100)
Amoxicillin	0	80 (100)
Ceftazidime	34 (42.5)	46 (57.5)
Cefotaxime	9 (11.2)	71 (88.8)

Out of 80 Ps. aeruginosa isolates, 54 (68%) were Pyocyanin pigment producers, while 26 (32%) were not pigment producers. There was a significant association between pyocyanin pigment production and site of infection (P=0.000) (Figure 1). There was also a significant association between pigment production and resistance to Chloramphenicol (P=0.020) and Cefotaxime (P=0.000), while there was insignificant association between pigment production and resistance to other antimicrobials used in this study (Figure 2).

Figure 1. Frequency of Pseudomonas aeruginosa pigment producing isolates according to site of infection.

Figure 2. Frequency of Pseudomonas aeruginosa pigment producing isolates according to antimicrobial resistance.

Molecular detection of ESBLs showed that 43 (54%) of the isolates were positive for at least one ESBLs gene, while 37 (46%) were negative for all genes (Figure 3). The frequency of ESBLs gene presence among Ps. aeruginosa was as follows: bla_TEM, 19 (44.2%); bla_SHV, 16 (37.2%); bla_CTX-M1, 10 (23.3%); bla_VEB, 14 (32.6%); and bla_OXA-1, 7 (16.3%). There was a significant association between the presence of ESBL genes in Ps. aeruginosa and site of infection (P=0.030) (Figure 3). Co-presence of more than one ESBLs gene among Ps. aeruginosa clinical isolates is presented in Table 3.

Figure 3. Presence of extended spectrum β-lactamases (ESBLs) among Pseudomonas aeruginosa isolates site of infection.

Table 3. Number of Pseudomonas aeruginosa isolates exhibiting co-presence of two extended spectrum β-lactamases genes.

	bla_TEM	bla_SHV	bla_CTXM-1	bla_VEB	bla_OXA-1
*bla*_TEM	7	6	5	3	1
*bla*_SHV	6	4	4	4	1
*bla*_CTXM-1	5	4	0	1	1
*bla*_VEB	3	4	1	3	3
*bla*_OXA-1	1	1	1	3	2

Class C β-lactamases gene were positive in 27 (34%) Ps. aeruginosa isolates; while 53 (66%) were negative (Figure 4). The frequency of class C β-lactamases genes was as follows: bla_AmpC, 22 (81.5%); bla_DHA, 8 (29.6%); and 3 (11.1%) isolates were positive for both genes. Association between presence of Class C β-lactamases genes and site of infection was insignificant (P=0.215) (Figure 4).

Figure 4. Presence of class C genes among Pseudomonas aeruginosa isolates and site of infection.

In total, 25% of Ps. aeruginosa isolates were positive for both ESBLs and class C β-lactamase genes (Figure 5). Co-presence of ESBLs genes and class C β-lactamase among Ps. aeruginosa clinical isolates is presented in Table 4.

Figure 5. Distribution of extended spectrum β-lactamases (ESBLs) and class C β-lactamase genes among Pseudomonas aeruginosa isolates.

Table 4. Number of P. aeruginosa isolates exhibiting extended spectrum β-lactamases (ESBLs) and class C genes.

Number of genes	ESBLs	Class C	Both classes	Total
1	16	6	-	22
2	7	1	9	17
3	-	-	6	6
4	-	-	5	5
5	-	-	1	1
6	-	-	-	0
7	-	-	-	0

Number of genes per isolate*

Discussion

Pseudomonas aeruginosa is one of the main causative agents of serious nosocomial infections with increased reports of β-lactams resistant strains that makes treatment difficult and complicated^¹⁹. Production of β-lactamases is one of the most common mechanisms of β-lactam resistance^³⁶.

In this study the frequency of ESBL genes among Ps. aeruginosa isolates was 53.8%. This frequency is close to a report from India by Qureshi and Bhatnagar (2016)^³⁷, where the frequency of ESBLs in Ps. aeruginosa isolates was 46%. However, the results of this study disagree with another report from India by Gupta et al. (2016)³⁸ where the frequency of ESBLs in Ps. aeruginosa isolates was 22.9%. These discrepancies could be due to differences in strains of the clinical isolates, the antibiotics used or sample size.

The most abundant gene among the ESBLs producing Ps. aeruginosa isolates detected in this study was bla_TEM gene (19, 44.2%), followed by bla_SHV, bla_VEB, bla_CTXM_-1 and bla_OXA-1 (16 (37.2%), 14 (32.6%), 10 (23.3%) and 7 (16.3%), respectively). Similar results were reported by Salah et al. (2016)³⁹ in Egypt concerning the presence of bla_TEM, bla_SHV and bla_OXA-1 (50%, 33% and 17%, respectively). The frequency of bla_TEM gene is also similar to that reported by Rafiee et al. (2014)⁴⁰, which was present in 39.2% of isolates. In a study in Iran by Sales et al. (2017)⁴¹, similar results were reported concerning the presence of bla_CTXM-1 (27.3%), while in India Jamali et al. (2017)¹⁵ reported a higher frequency (57.5%) of this gene.

On the other hand, the frequency of bla_VEB and bla_SHV genes in this study differs from that reported in Iran by Bokaeian et al. (2014)⁴² where bla_VEB gene frequency was 13.3%, while the frequency of bla_SHV gene was 6.6%. The report by Jamali et al. (2017)¹⁵ concerning the genes bla_TEM (15%) and bla_SHV (75%) are also different from those reported in this study, and this could be due to the variation in strains of clinical isolates and the sample size used.

In this study, the frequency of class C β-lactamase genes in Ps. aeruginosa isolates was 27 (34%). This result is close to a report from India by Gupta et al. (2016)³⁸ where 43% of Ps. aeruginosa were AmpC producers, and disagrees with a report from Thailand by Katvoravutthichai et al. (2016)⁴³ where 11% of Ps. aeruginosa isolates were AmpC producers. In this study, out of the class C β- lactamase producing Ps. aeruginosa isolates, 22 (81.5%) and 8 (29.6%) isolates were positive for bla_AmpC and bla_DHA genes, respectively. Qureshi and Bhatnagar (2016)³⁷ in India reported that no Ps. aeruginosa isolates were positive for bla_AmpC gene, while Rafiee et al. (2014)⁴⁰ in Iran reported that 60.8% of Ps. aeruginosa were positive for bla_AmpC gene.

All Ps. aeruginosa clinical isolates tested in our study were resistant to Amoxicillin and Amoxyclav and this may be due to the misuse of antibiotics in Sudan⁴⁴, where plenty of antimicrobial agents are sold over the counter. This rate of resistance is higher than the rate of resistance reported by Ahmad et al. (2016)⁴⁵ in Pakistan where the resistance to Amoxicillin and Amoxyclav was 73.4% and 67.7% respectively, and this could be justified by the time difference between the studies, as well as the difference in the strains and antibiotics used.

The resistance rate of Ps. aeruginosa to Imipenem was 10% (n=8). This may be due to the infrequent use of Imipenem antibiotics. This percentage agrees with a study reported in Pakistan by Ahmad et al. (2016)⁴⁵ where 11.1% of Ps. aeruginosa isolates were resistant to Imipenem, while in Sudan Altom and Ahmed (2015)⁴⁶ reported that 5.7% Ps. aeruginosa isolates were resistant to Imipenem. This finding may indicate that carbapenem resistance is on the rise in Ps. aeruginosa isolates from Sudan.

In this study, the number of Ps. aeruginosa isolates resistant to Cefotaxime, Chloramphenicol and Ceftazidime was 71 (88.8%), 71 (88.8%) and 46 (57.5%), respectively. The rate of resistance to Cefotaxime in this study is different from that reported in Pakistan by Ahmad et al. (2016)⁴⁵ who found that 20.3% of Ps. aeruginosa isolates were resistant to Ceftazidime. The resistance rate in this study also disagrees with that reported by Albadawi (2010)⁴⁷ in Sudan who found that resistance of Ps. aeruginosa to Ceftazidime and Cefotaxime were 31% and 42%, respectively. These findings also indicate the rapidly increasing rates of Ps. aeruginosa resistance to antimicrobial agents in Sudan perhaps due to antibiotic misuse.

In this study, 23 (28.8%) and 19 (23.8%) of Ps. aeruginosa clinical isolates were resistant to Ciprofloxacin and Gentamicin, respectively. Altom and Ahmed (2015)⁴⁶ in Sudan also reported that 18.6% of Ps. aeruginosa were resistant to Gentamicin. Different results were reported by Ahmad et al. (2016)⁴⁵, where the percentage of resistance to Gentamicin and Ciprofloxacin were 74.3% and 44%, respectively. These percentages are much higher than those reported in this study probably due to their different geographical location, study time difference and the antibiotic-use rates.

In this study, there was significant association between ESBLs production and site of infection (P=0.030). Ps. aeruginosa isolated from blood showed the highest ESBLs production followed by ear swab, urine, sputum and wound swab. This result agrees with a study in India reported by Basak et al. (2012)⁴⁸ where the highest ESBLs producing Ps. aeruginosa isolates were from blood, but disagrees with Azizi et al. (2015)⁴⁹ in Iran who found that highest ESBLs production was in Ps. aeruginosa isolated from wound followed by urine, sputum and blood. There was insignificant association between the presence of class C β-lactamase genes and site of infection (P=0.215) found in the present study. The highest frequency of class C β-lactamases genes in Ps. aeruginosa were isolated from blood followed by urine, ear swab, wound swab and sputum. These results agree with the study in India reported by Basak et al. (2012)⁴⁸ in that the highest percentage of class C β-lactamase genes in Ps. aeruginosa were found in blood.

In the present study, there were four clinical isolates phenotypically sensitive to third generation cephalosporins (Ceftazidime and Cefotaxime) and genotypically positive for ESBLs genes. This result indicates that Ps. aeruginosa may carry hidden unexpressed genes that could be detected through molecular techniques. This result agrees with a study in India reported by Bajpai et al. (2017)⁵⁰ where out of 38 phenotypically ESBL-negative isolates, 20 isolates were positive for ESBLs genes.

In this study, the frequency of pigment producing Ps. aeruginosa isolates was 67.5%. In a study in India a higher percentage was reported where 82.5% of Ps. aeruginosa were pigment producers (Finlayson and Brown, 2011)⁵¹. The present study revealed that there was no relationship between pigment production and pattern of antimicrobial resistance, except in Chloramphenicol (P=0.02) and Cefotaxime (P=0.00).

In this study, the relationship between pigment production and site of infection was significant (P=0.000). Ps. aeruginosa isolated from wound infections were the highest pigment producing isolates followed by isolates from blood, urine and sputum. There was no pigment production in Ps. aeruginosa isolated from ear infections in this study.

The variations between the results of this study and other reports could be attributed to the difference in antibiotic usage patterns in each region, economical causes, geographical differences, sample size, differences in time in which the studies were performed, and study population. Despite the significance of the present study, there were limitations that should be avoided in future studies, such as the small sample size, phenotypic detection of β-lactamases, coverage of other β-lactamase classes, and gene sequencing should be done in order to confirm and to identify all the genes that are carried by Ps. aeruginosa strains in Sudan.

Conclusion

This is study is of great importance as it raises attention to the existing problem of resistance to β-lactams in Ps. aeruginosa in Sudan. This study confirms the reports that a number of antibiotics are becoming useless for treating this problematic bacterium, since all the strains of Ps. aeruginosa isolates in this study were resistant to Amoxicillin and Amoxyclav. The best antibiotic sensitivity results obtained in this study were those of Imipenem, followed by Gentamicin and Ciprofloxacin. Moreover, Ps. aeruginosa isolates showed an increased rate of β-lactamase production with co-resistance with other classes of antibiotics. Of interest is the finding that clinical isolates were resistant phenotypically in high frequencies to Amoxicillin, Amoxyclav and a third generation antibiotic, Cephalosporin, and showed negative results genotypically, indicating that resistance to this family of antibiotics also exist by resistance mechanisms other than β-lactamases production. Also, our PCR results revealed that Ps. aeruginosa possesses hidden β-lactamases genes that can’t be detected phenotypically. Finally, this study highlighted for the first time the problem of misidentification of Ps. aeruginosa and other microorganisms in Khartoum hospitals as only 80 out of the 120 alleged isolates were confirmed to be Ps. aeruginosa through PCR.

Data availability

Underlying data

Figshare: SPSS, https://doi.org/10.6084/m9.figshare.12453287.v2⁵¹

This project contains the following underlying data:

SPSS. sav (Result sheet for beta-lactamases detection and sensitivity testing)
Data Dictionary. docx

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgements

Deep thanks to all the Microbiology Department team at Sudan University of Science and Technology for their significant help during the study. We are especially thankful to Mariam Awad Ahmed Suliman for her kind support and great advice throughout the study and very special thanks to Dr. Ahmed Bakheet Abd Alla for his kind guidance and support.

Faculty Opinions recommended

References

1. Forbes BA, Sahm DF, Weissfeld AS: Study guide for Bailey & Scott’s diagnostic microbiology. Mosby USA; 2007. Reference Source
2. Glupczynski Y, Bogaerts P, Deplano A, et al.: Detection and characterization of class A extended-spectrum-β-lactamase-producing Pseudomonas aeruginosa isolates in Belgian hospitals. J Antimicrob Chemother. 2010; 65(5): 866–71. PubMed Abstract | Publisher Full Text
3. Lin SP, Liu MF, Lin CF, et al.: Phenotypic detection and polymerase chain reaction screening of extended-spectrum β-lactamases produced by Pseudomonas aeruginosa isolates. J Microbiol Immunol Infect. 2012; 45(3): 200–7. PubMed Abstract | Publisher Full Text
4. Agouri SR: Genetic characterisation of MBL positive pseudomonas and Enterobacteriaceae. Cardiff University; 2014. Reference Source
5. Beta-lactamases B, d Inhibitor Resistant T: Extended spectrum beta-lactamases.
6. Ghafourian S, Sadeghifard N, Soheili S, et al.: Extended spectrum beta-lactamases: definition, classification and epidemiology. Curr Issues Mol Biol. 2014; 17(1): 11–22. PubMed Abstract
7. Mshana S: Department of Microbiology/Immunology, Weill Bugando University College of Health Sciences a Constituent College of St Augustine University of Tanzania: St. Augustine University of Tanzania. 2011. Reference Source
8. Poirel L, Weldhagen GF, De Champs C, et al.: A nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum β-lactamase GES-2 in South Africa. J Antimicrob Chemother. 2002; 49(3): 561–5. PubMed Abstract | Publisher Full Text
9. Lee S, Park YJ, Kim M, et al.: Prevalence of Ambler class A and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother. 2005; 56(1): 122–7. PubMed Abstract | Publisher Full Text
10. Jiang X, Zhang Z, Li M, et al.: Detection of extended-spectrum β-lactamases in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2006; 50(9): 2990–5. PubMed Abstract | Publisher Full Text | Free Full Text
11. Bahmani N, Ramazanzadeh R: Detection of SHV type extended-spectrum B-lactamase and risk factors in pseudomonas aeruginosa clinical isolates. Pak J Med Sci. 2013; 29(3): 788–92. PubMed Abstract | Publisher Full Text | Free Full Text
12. Vala MH, Hallajzadeh M, Hashemi A, et al.: Detection of Ambler class A, B and D ß-lactamases among pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014; 27(1): 8–13. PubMed Abstract | Free Full Text
13. Chen Z, Niu H, Chen G, et al.: Prevalence of ESBLs-producing pseudomonas aeruginosa isolates from different wards in a Chinese teaching hospital. Int J Clin Exp Med. 2015; 8(10): 19400–5 . PubMed Abstract | Free Full Text
14. Elhariri M, Hamza D, Elhelw R, et al.: Extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa in camel in Egypt: potential human hazard. Ann Clin Microbiol Antimicrob. 2017; 16(1): 21. PubMed Abstract | Publisher Full Text | Free Full Text
15. Jamali S, Shahid M, Sobia F, et al.: Phenotypic and molecular characterization of cefotaximases, temoniera, and sulfhydryl variable β-lactamases in Pseudomonas and Acinetobacter isolates in an Indian tertiary health-care center. Indian J Pathol Microbiol. 2017; 60(2): 196–205. PubMed Abstract | Publisher Full Text
16. Peymani A, Naserpour-Farivar T, Zare E, et al.: Distribution of bla_TEM, bla_SHV, and bla_CTX-M genes among ESBL-producing P. aeruginosa isolated from Qazvin and Tehran hospitals, Iran. J Prev Med Hyg. 2017; 58(2): E155. PubMed Abstract | Free Full Text
17. Kaur A, Singh S: Prevalence of Extended Spectrum Betalactamase (ESBL) and Metallobetalactamase (MBL) Producing Pseudomonas aeruginosa and Acinetobacter baumannii Isolated from Various Clinical Samples. J Pathog. 2018; 2018: 6845985. PubMed Abstract | Publisher Full Text | Free Full Text
18. Fouch S: Molecular epidemiological study of extended spectrum betalactamase (ESBL) producing bacteria from teaching and district general hospitals within Hampshire. University of Portsmouth; 2015. Reference Source
19. Tam V, Schilling A, LaRocco M, et al.: Prevalence of AmpC over-expression in bloodstream isolates of Pseudomonas aeruginosa. Clin Microbiol Infect. 2007; 13(4): 413–8. PubMed Abstract | Publisher Full Text
20. Tomás M, Doumith M, Warner M, et al.: Efflux pumps, OprD porin, AmpC β-lactamase, and multiresistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Antimicrob Agents Chemother. 2010; 54(5): 2219–24. PubMed Abstract | Publisher Full Text | Free Full Text
21. Bhattacharjee A, Anupurba S, Gaur A, et al.: Prevalence of inducible AmpC β-lactamase-producing Pseudomonas aeruginosa in a tertiary care hospital in northern India. Indian J Med Microbiol. 2008; 26(1): 89–91. PubMed Abstract | Publisher Full Text
22. Lee JY, Ko KS: OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-β-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. Int J Antimicrob Agents. 2012; 40(2): 168–72. PubMed Abstract | Publisher Full Text
23. Mirsalehian A, Kalantar-Neyestanaki D, Nourijelyani K, et al.: Detection of AmpC-β-lactamases producing isolates among carbapenem resistant P. aeruginosa isolated from burn patient. Iran J Microbiol. 2014; 6(5): 306–10. PubMed Abstract | Free Full Text
24. Neyestanaki DK, Mirsalehian A, Rezagholizadeh F, et al.: Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns. 2014; 40(8): 1556–61. PubMed Abstract | Publisher Full Text
25. Berrazeg M, Jeannot K, Enguéné VYN, et al.: Mutations in ß-lactamase AmpC increase resistance of Pseudomonas aeruginosa isolates to antipseudomonal cephalosporins. Antimicrob Agents Chemother. 2015; 59(10): 6248–55. PubMed Abstract | Publisher Full Text | Free Full Text
26. Calvopiña K, Silva MG, Vallejo MJ, et al.: AmpC, oprD Expression Analysis in β-lactam Resistant Pseudomonas aeruginosa Clinical Isolates 1 from a Tertiary Level Hospital in Ecuador. Rev Ecuat Med Cienc Biol. 2017; 38(1): 35–43. Reference Source
27. Oliveira LG, Ferreira LGR, Nascimento AMA, et al.: Antibiotic resistance profile and occurrence of AmpC between Pseudomonas aeruginosa isolated from a domestic full-scale WWTP in southeast Brazil. Water Sci Technol. 2017; 2017(1): 108–14. PubMed Abstract | Publisher Full Text
28. Jalali HR, Pourbakhsh A, Fallah F, et al.: Genotyping of Virulence Factors of Uropathogenic Escherichia coli by PCR. Novelty in Biomedicine. 2015; 3(4): 177–81. Reference Source
29. Khattab M, Nour M, ElSheshtawy N: Genetic identification of Pseudomonas aeruginosa virulence genes among different isolates. J Microb Biochem Technol. 2015; 7(5): 274–7. Publisher Full Text
30. Mathlouthi N, Al-Bayssari C, El Salabi A, et al.: Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals. J Infect Dev Ctries. 2016; 10(7): 718–27. PubMed Abstract | Publisher Full Text
31. Saishu N, Ozaki H, Murase T: CTX-M-type extended-spectrum β-lactamase-producing Klebsiella pneumoniae isolated from cases of bovine mastitis in Japan. J Vet Med Sci. 2014; 76(8): 1153–6. PubMed Abstract | Publisher Full Text | Free Full Text
32. Hujer AM, Page MG, Helfand MS, et al.: Development of a sensitive and specific enzyme-linked immunosorbent assay for detecting and quantifying CMY-2 and SHV beta-lactamases. J Clin Microbiol. 2002; 40(6): 1947–57. PubMed Abstract | Publisher Full Text | Free Full Text
33. Liu XQ, Liu YR: Detection and genotype analysis of AmpC β-lactamase in Klebsiella pneumoniae from tertiary hospitals. Exp Ther Med. 2016; 12(1): 480–4. PubMed Abstract | Publisher Full Text | Free Full Text
34. Finlayson E, Brown P: Comparison of antibiotic resistance and virulence factors in pigmented and non-pigmented Pseudomonas aeruginosa. West Indian Med J. 2011; 60(1): 24–32. PubMed Abstract
35. Magoué CL, Melin P, Gangoue-Pieboji J, et al.: Prevalence and spread of extended-spectrum β-lactamase-producing Enterobacteriaceae in Ngaoundere, Cameroon. Clin Microbiol Infect. 2013; 19(9): E416–E20. PubMed Abstract | Publisher Full Text
36. Altayb HN, Siddig MA, El Amin NM, et al.: Molecular Characterization of CTX-M ESBLs among Pathogenic Enterobacteriaceae isolated from different regions in Sudan. 2018. Reference Source
37. Qureshi MA, Bhatnagar RK: Phenotypic Characterization of ESBL, AmpC and MBL Producers among the Clinical Isolates of Multidrug Resistant Pseudomonas aeruginosa. Int J Curr Microbiol App Sci. 2016; 5(10): 749–58. Publisher Full Text
38. Gupta R, Malik A, Rizvi M, et al.: Incidence of multidrug-resistant Pseudomonas spp. In ICU patients with special reference to ESBL, AMPC, MBL and biofilm production. J Glob Infect Dis. 2016; 8(1): 25–31. PubMed Abstract | Publisher Full Text | Free Full Text
39. Salah M, Azab M, Halaby H, et al.: Mutations in β-lactamases detected in multidrug resistant gram negative bacteria isolated from community acquired urinary tract infections in Assiut, Egypt. Afr J Microbiol Res. 2016; 10(46): 1938–43. Publisher Full Text
40. Rafiee R, Eftekhar F, Tabatabaei SA, et al.: Prevalence of extended-spectrum and metallo β-lactamase production in AmpC β-lactamase producing Pseudomonas aeruginosa isolates from burns. Jundishapur J Microbiol. 2014; 7(9): e16436. PubMed Abstract | Publisher Full Text | Free Full Text
41. Sales A, Fathi R, Mobaiyen H: Molecular Study of the Prevalence of CTX-M1, CTX-M2, CTXM3 in Pseudomonas aeruginosa Isolated from Clinical Samples in Tabriz Town, Iran. Electronic J Biol. 2017; 13(3): 253–259. Reference Source
42. Bokaeian M, Zahedani SS, Bajgiran MS, et al.: Frequency of PER, VEB, SHV, TEM and CTX-M genes in resistant strains of Pseudomonas aeruginosa producing extended spectrum β-lactamases. Jundishapur J Microbiol. 2014; 8(1): e13783. PubMed Abstract | Publisher Full Text | Free Full Text
43. Katvoravutthichai C, Boonbumrung K, Tiyawisutsri R: Prevalence of β-lactamase classes A, C, and D among clinical isolates of Pseudomonas aeruginosa from a tertiary-level hospital in Bangkok, Thailand. Genet Mol Res. 2016; 15(3). PubMed Abstract | Publisher Full Text
44. Awad A, Eltayeb I, Baraka O: Changing antibiotics prescribing practices in health centers of Khartoum State, Sudan. Eur J Clin Pharmacol. 2006; 62(2): 135–42. PubMed Abstract | Publisher Full Text
45. Ahmad M, Hassan M, Khalid A, et al.: Prevalence of extended spectrum β-lactamase and antimicrobial susceptibility pattern of clinical isolates of Pseudomonas from patients of Khyber Pakhtunkhwa, Pakistan. Biomed Res Int. 2016; 2016: 6068429. PubMed Abstract | Publisher Full Text | Free Full Text
46. Altom RB, Ahmed ST: Antimicrobial Susceptibility of Clinical Isolates of Pseudomonas aeruginosa to Aminoglycosides and Imipenem. B. Sc dissertation. Sudan University of Science and Technology. 2015.
47. Albadawi SA: Determination of Antimicrobial Susceptibility of Pseudomonas aeruginosa Isolated from Sudanese Patients. Post graduate Diploma dissertation. Sudan University of Science and Technology. 2010.
48. Basak S, Attal RO, Rajurkar M: Pseudomonas aeruginosa and newer β-lactamases: an emerging resistance threat. Infection Control-Updates: InTech. 2012. Publisher Full Text
49. Azizi H, Kheirandish F, Mirzaei M: Frequency of Extended-Spectrum Beta-Lactamase (ESBLs)-Multidrug Resistance Produced by Pseudomonas aeruginosa Isolated from Clinical Specimens in Khorramabad City, Iran. Br Microbiol Res J. 2015; 5(6): 490. Publisher Full Text
50. Bajpai T, Pandey M, Varma M, et al.: Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med. 2017; 7(1): 12–16. PubMed Abstract | Publisher Full Text | Free Full Text
51. Abdelrahman DN, Taha AA, Dafaallah MM, et al.: SPSS. figshare. Dataset. 2020. http://www.doi.org/10.6084/m9.figshare.12453287.v2

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 27 Jul 2020

Author details Author details

Aya A. Taha
Roles: Investigation, Methodology, Resources, Validation, Visualization

Mazar M. Dafaallah
Roles: Investigation, Methodology, Resources, Visualization

Alaa Abdelgafoor Mohammed
Roles: Investigation, Visualization

Abdel Rahim M. El Hussein
Roles: Writing – Review & Editing

Ahmed I. Hashim
Roles: Investigation, Methodology, Software, Writing – Review & Editing

Yousif F. Hamedelnil
Roles: Conceptualization, Investigation, Methodology, Supervision

Hisham N. Altayb
Roles: Conceptualization, Data Curation, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

The author(s) declared that no grants were involved in supporting this work.

Article Versions (3)

version 3

Revised

Published: 01 Apr 2021, 9:774

https://doi.org/10.12688/f1000research.24818.3

version 2

Revised

Published: 15 Sep 2020, 9:774

https://doi.org/10.12688/f1000research.24818.2

version 1

Published: 27 Jul 2020, 9:774

https://doi.org/10.12688/f1000research.24818.1

© 2020 Abdelrahman DN et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Abdelrahman DN, Taha AA, Dafaallah MM et al. Extended spectrum β-lactamases and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study [version 1; peer review: 1 not approved]. F1000Research 2020, 9:774 (https://doi.org/10.12688/f1000research.24818.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 27 Jul 2020

Views

Reviewer Report 26 Aug 2020

Nobumichi Kobayashi, Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo, Japan

Not Approved

https://doi.org/10.5256/f1000research.27382.r68073

This is a kind of primitive study that provides only limited information. Only importance is that this study was done in Sudan. However, still number of isolates were low, and errors in descriptions of technical terms are found in this ... Continue reading

Abstract: Number of P. aeruginosa should be written as "80". "121" should not appear here, because 41 isolates were not P. aeruginosa.
"Ps. aeruginosa" should be corrected as "P. aeruginosa", as formal abbreviation.
Amoxyclav may be a commercial name of the drug. It should be written as general name. Maybe it is "amoxicillin/clavulanate".
Authors may have serious misunderstanding regarding the term of ESBL. NOT all of TEM, SHV, OXA type beta-lactamases are ESBL. TEM-1, 2, SHV-1, OXA-1 are not ESBL. Other subtypes of TEM, SHV, and OXA are called as "ESBL". Those subtypes can be identified only by sequencing of full-length ORF of these genes. In this manuscript, only CTX-M type gene can be called as "ESBL". However, it is not sure that TEM, SHV, OXA type genes are ESBL genes or not, because sequence was not determined. In this regard, this manuscript must be revised substantially. Authors can mention CTX-M as ESBL, others should not be referred as ESBL, but just individual enzyme nams, e.g., "TEM gene". According to this alteration, whole manuscript should be rewitten.
CTX-M-1 should be written as "CTX-M-1 group". CTX-M types cannot be determined by only PCR. Authors should read and study literature on ESBL and betalactamases of bacteria, to exactly understand their nomenclature and definition.
Table 3 cannot be understood. Authors should make a table to show combination pattern of beta-lactamases and their frequency.
Figure 5: "Class AmpC genes" is wrong. It should be "Class C beta-lactamase" or "AmpC gene". In this case, "AmpC gene" is better.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: microbiology, public health

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Author Response 15 Sep 2020

Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan

15 Sep 2020

Author Response
- Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and
... Continue reading
Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and classified as β-lactamases group.

This change applied in the whole draft including tables and figures, even the title changed to “β-lactamases (bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB, bla _OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study”

In abstract: The sample size mentioned as the confirmed 80 P. aeruginosa isolates, the remaining 41 isolate other than P. aeruginosa deleted.

All “Ps. aeruginosa” in the text changed to “P. aeruginosa” as formal abbreviation.

All “Amoxyclav” in the text changed to “amoxicillin/clavulanate”

"Class AmpC genes" in figure 5 changed to “Class C β -lactamase”

“ESBLs” changed to “β- lactamases” in figure 3 and figure 5.
Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and classified as β-lactamases group.

This change applied in the whole draft including tables and figures, even the title changed to “β-lactamases (bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB, bla _OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study”

In abstract: The sample size mentioned as the confirmed 80 P. aeruginosa isolates, the remaining 41 isolate other than P. aeruginosa deleted.

All “Ps. aeruginosa” in the text changed to “P. aeruginosa” as formal abbreviation.

All “Amoxyclav” in the text changed to “amoxicillin/clavulanate”

"Class AmpC genes" in figure 5 changed to “Class C β -lactamase”

“ESBLs” changed to “β- lactamases” in figure 3 and figure 5.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 15 Sep 2020

Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan

15 Sep 2020

Author Response
- Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and
... Continue reading
Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and classified as β-lactamases group.

This change applied in the whole draft including tables and figures, even the title changed to “β-lactamases (bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB, bla _OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study”

In abstract: The sample size mentioned as the confirmed 80 P. aeruginosa isolates, the remaining 41 isolate other than P. aeruginosa deleted.

All “Ps. aeruginosa” in the text changed to “P. aeruginosa” as formal abbreviation.

All “Amoxyclav” in the text changed to “amoxicillin/clavulanate”

"Class AmpC genes" in figure 5 changed to “Class C β -lactamase”

“ESBLs” changed to “β- lactamases” in figure 3 and figure 5.
Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and classified as β-lactamases group.

This change applied in the whole draft including tables and figures, even the title changed to “β-lactamases (bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB, bla _OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study”

In abstract: The sample size mentioned as the confirmed 80 P. aeruginosa isolates, the remaining 41 isolate other than P. aeruginosa deleted.

All “Ps. aeruginosa” in the text changed to “P. aeruginosa” as formal abbreviation.

All “Amoxyclav” in the text changed to “amoxicillin/clavulanate”

"Class AmpC genes" in figure 5 changed to “Class C β -lactamase”

“ESBLs” changed to “β- lactamases” in figure 3 and figure 5.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 27 Jul 2020

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 3 (revision) 01 Apr 21
Version 2 (revision) 15 Sep 20	read	read
Version 1 27 Jul 20	read

Nobumichi Kobayashi, Sapporo Medical University School of Medicine, Sapporo, Japan
Muhammad Qasim, Kohat University of Science and Technology, Kohat, Pakistan

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

14 Views

14 Dec 2020 | for Version 2

Muhammad Qasim, Department of Microbiology, Kohat University of Science and Technology, Kohat, Pakistan

14 Views Cite this report Responses(1)

Approved

The manuscript “Extended spectrum β-lactamases and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study” describe important findings on drug resistance (ESBL and Class C Beta lactamases) of P. aeruginosa in Khartoum State, Sudan. The author claimed the study to be the first one to describe the exact frequency of ESBL producing P. aeruginosa in Khartoum, Sudan.

On the whole the research is scientifically carried out and written. Following are few minor suggestions

In the abstract section, the author has mentioned that 40 isolates were other bacterial species. I think the objective of the study is the molecular detection of beta lactamases in P.aeruginosa so there is no need mention about other bacterial species.
The statement “121 Ps. aeruginosa clinical isolates from various clinical specimens were used in this cross-sectional study conducted in Khartoum State. A total of 80 isolates were confirmed as Ps. aeruginosa through conventional identification methods and species specific primers” is really confusing. If 80 P. aeruginosa isolates were finally analyzed for drug resistance then there no need to state 121 P. aeruginosa clinical isolates.
As mentioned above the focus of manuscript is drug resistance in P. aeruginosa, so the irrelevant information such as Pyocyanin pigment production should be deleted.
Though in methodology section, the author has claimed statistical tests (chi square, p value), but there is no information on statistical tests in figures. I think statistical values should be included in figures.
In all tables, please proper define the abbreviations, number and percentage (n(%)) in foot note.
Figures should be properly labeled (Frequency (n)).
The percentage should be added in all tables, as it will help the readers to understand and interpret the tables in better way.
Some of the references are inconsistent/incomplete which should be arranged as per journal format.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Medical Microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (1)

Back to all reports

Reviewer Report

11 Views

22 Sep 2020 | for Version 2

Nobumichi Kobayashi, Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo, Japan

11 Views Cite this report Responses(0)

Approved

The revised version is described appropriately using correct scientific terms.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

microbiology, public health

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

24 Views

26 Aug 2020 | for Version 1

Nobumichi Kobayashi, Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo, Japan

24 Views Cite this report Responses(1)

Not Approved

Abstract: Number of P. aeruginosa should be written as "80". "121" should not appear here, because 41 isolates were not P. aeruginosa.
"Ps. aeruginosa" should be corrected as "P. aeruginosa", as formal abbreviation.
Amoxyclav may be a commercial name of the drug. It should be written as general name. Maybe it is "amoxicillin/clavulanate".
Authors may have serious misunderstanding regarding the term of ESBL. NOT all of TEM, SHV, OXA type beta-lactamases are ESBL. TEM-1, 2, SHV-1, OXA-1 are not ESBL. Other subtypes of TEM, SHV, and OXA are called as "ESBL". Those subtypes can be identified only by sequencing of full-length ORF of these genes. In this manuscript, only CTX-M type gene can be called as "ESBL". However, it is not sure that TEM, SHV, OXA type genes are ESBL genes or not, because sequence was not determined. In this regard, this manuscript must be revised substantially. Authors can mention CTX-M as ESBL, others should not be referred as ESBL, but just individual enzyme nams, e.g., "TEM gene". According to this alteration, whole manuscript should be rewitten.
CTX-M-1 should be written as "CTX-M-1 group". CTX-M types cannot be determined by only PCR. Authors should read and study literature on ESBL and betalactamases of bacteria, to exactly understand their nomenclature and definition.
Table 3 cannot be understood. Authors should make a table to show combination pattern of beta-lactamases and their frequency.
Figure 5: "Class AmpC genes" is wrong. It should be "Class C beta-lactamase" or "AmpC gene". In this case, "AmpC gene" is better.

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

Partly
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Partly
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

microbiology, public health

Respond to this report

Responses (1)

Author Response

15 Sep 2020

Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan

Classification of bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB and bla _OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and classified as β-lactamases group.

This change applied in the whole draft including tables and figures, even the title changed to “β-lactamases (bla _TEM, bla _SHV, bla _CTXM-1, bla _VEB, bla _OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study”

In abstract: The sample size mentioned as the confirmed 80 P. aeruginosa isolates, the remaining 41 isolate other than P. aeruginosa deleted.
All “Ps. aeruginosa” in the text changed to “P. aeruginosa” as formal abbreviation.
All “Amoxyclav” in the text changed to “amoxicillin/clavulanate”
"Class AmpC genes" in figure 5 changed to “Class C β -lactamase”
“ESBLs” changed to “β- lactamases” in figure 3 and figure 5.

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Forbes BA, Sahm DF, Weissfeld AS: Study guide for Bailey & Scott’s diagnostic microbiology. Mosby USA; 2007. Reference Source

[2] 2. Glupczynski Y, Bogaerts P, Deplano A, et al.: Detection and characterization of class A extended-spectrum-β-lactamase-producing Pseudomonas aeruginosa isolates in Belgian hospitals. J Antimicrob Chemother. 2010; 65(5): 866–71. PubMed Abstract | Publisher Full Text

[3] 3. Lin SP, Liu MF, Lin CF, et al.: Phenotypic detection and polymerase chain reaction screening of extended-spectrum β-lactamases produced by Pseudomonas aeruginosa isolates. J Microbiol Immunol Infect. 2012; 45(3): 200–7. PubMed Abstract | Publisher Full Text

[4] 4. Agouri SR: Genetic characterisation of MBL positive pseudomonas and Enterobacteriaceae. Cardiff University; 2014. Reference Source

[5] 5. Beta-lactamases B, d Inhibitor Resistant T: Extended spectrum beta-lactamases.

[6] 6. Ghafourian S, Sadeghifard N, Soheili S, et al.: Extended spectrum beta-lactamases: definition, classification and epidemiology. Curr Issues Mol Biol. 2014; 17(1): 11–22. PubMed Abstract

[7] 7. Mshana S: Department of Microbiology/Immunology, Weill Bugando University College of Health Sciences a Constituent College of St Augustine University of Tanzania: St. Augustine University of Tanzania. 2011. Reference Source

[8] 8. Poirel L, Weldhagen GF, De Champs C, et al.: A nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum β-lactamase GES-2 in South Africa. J Antimicrob Chemother. 2002; 49(3): 561–5. PubMed Abstract | Publisher Full Text

[9] 9. Lee S, Park YJ, Kim M, et al.: Prevalence of Ambler class A and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother. 2005; 56(1): 122–7. PubMed Abstract | Publisher Full Text

[10] 10. Jiang X, Zhang Z, Li M, et al.: Detection of extended-spectrum β-lactamases in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2006; 50(9): 2990–5. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Bahmani N, Ramazanzadeh R: Detection of SHV type extended-spectrum B-lactamase and risk factors in pseudomonas aeruginosa clinical isolates. Pak J Med Sci. 2013; 29(3): 788–92. PubMed Abstract | Publisher Full Text | Free Full Text

[12] 12. Vala MH, Hallajzadeh M, Hashemi A, et al.: Detection of Ambler class A, B and D ß-lactamases among pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014; 27(1): 8–13. PubMed Abstract | Free Full Text

[13] 13. Chen Z, Niu H, Chen G, et al.: Prevalence of ESBLs-producing pseudomonas aeruginosa isolates from different wards in a Chinese teaching hospital. Int J Clin Exp Med. 2015; 8(10): 19400–5 . PubMed Abstract | Free Full Text

[14] 14. Elhariri M, Hamza D, Elhelw R, et al.: Extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa in camel in Egypt: potential human hazard. Ann Clin Microbiol Antimicrob. 2017; 16(1): 21. PubMed Abstract | Publisher Full Text | Free Full Text

[15] 15. Jamali S, Shahid M, Sobia F, et al.: Phenotypic and molecular characterization of cefotaximases, temoniera, and sulfhydryl variable β-lactamases in Pseudomonas and Acinetobacter isolates in an Indian tertiary health-care center. Indian J Pathol Microbiol. 2017; 60(2): 196–205. PubMed Abstract | Publisher Full Text

[16] 16. Peymani A, Naserpour-Farivar T, Zare E, et al.: Distribution of bla_TEM, bla_SHV, and bla_CTX-M genes among ESBL-producing P. aeruginosa isolated from Qazvin and Tehran hospitals, Iran. J Prev Med Hyg. 2017; 58(2): E155. PubMed Abstract | Free Full Text

[17] 17. Kaur A, Singh S: Prevalence of Extended Spectrum Betalactamase (ESBL) and Metallobetalactamase (MBL) Producing Pseudomonas aeruginosa and Acinetobacter baumannii Isolated from Various Clinical Samples. J Pathog. 2018; 2018: 6845985. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Fouch S: Molecular epidemiological study of extended spectrum betalactamase (ESBL) producing bacteria from teaching and district general hospitals within Hampshire. University of Portsmouth; 2015. Reference Source

[19] 19. Tam V, Schilling A, LaRocco M, et al.: Prevalence of AmpC over-expression in bloodstream isolates of Pseudomonas aeruginosa. Clin Microbiol Infect. 2007; 13(4): 413–8. PubMed Abstract | Publisher Full Text

[20] 20. Tomás M, Doumith M, Warner M, et al.: Efflux pumps, OprD porin, AmpC β-lactamase, and multiresistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Antimicrob Agents Chemother. 2010; 54(5): 2219–24. PubMed Abstract | Publisher Full Text | Free Full Text

[21] 21. Bhattacharjee A, Anupurba S, Gaur A, et al.: Prevalence of inducible AmpC β-lactamase-producing Pseudomonas aeruginosa in a tertiary care hospital in northern India. Indian J Med Microbiol. 2008; 26(1): 89–91. PubMed Abstract | Publisher Full Text

[22] 22. Lee JY, Ko KS: OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-β-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. Int J Antimicrob Agents. 2012; 40(2): 168–72. PubMed Abstract | Publisher Full Text

[23] 23. Mirsalehian A, Kalantar-Neyestanaki D, Nourijelyani K, et al.: Detection of AmpC-β-lactamases producing isolates among carbapenem resistant P. aeruginosa isolated from burn patient. Iran J Microbiol. 2014; 6(5): 306–10. PubMed Abstract | Free Full Text

[24] 24. Neyestanaki DK, Mirsalehian A, Rezagholizadeh F, et al.: Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns. 2014; 40(8): 1556–61. PubMed Abstract | Publisher Full Text

[25] 25. Berrazeg M, Jeannot K, Enguéné VYN, et al.: Mutations in ß-lactamase AmpC increase resistance of Pseudomonas aeruginosa isolates to antipseudomonal cephalosporins. Antimicrob Agents Chemother. 2015; 59(10): 6248–55. PubMed Abstract | Publisher Full Text | Free Full Text

[26] 26. Calvopiña K, Silva MG, Vallejo MJ, et al.: AmpC, oprD Expression Analysis in β-lactam Resistant Pseudomonas aeruginosa Clinical Isolates 1 from a Tertiary Level Hospital in Ecuador. Rev Ecuat Med Cienc Biol. 2017; 38(1): 35–43. Reference Source

[27] 27. Oliveira LG, Ferreira LGR, Nascimento AMA, et al.: Antibiotic resistance profile and occurrence of AmpC between Pseudomonas aeruginosa isolated from a domestic full-scale WWTP in southeast Brazil. Water Sci Technol. 2017; 2017(1): 108–14. PubMed Abstract | Publisher Full Text

[28] 28. Jalali HR, Pourbakhsh A, Fallah F, et al.: Genotyping of Virulence Factors of Uropathogenic Escherichia coli by PCR. Novelty in Biomedicine. 2015; 3(4): 177–81. Reference Source

[29] 29. Khattab M, Nour M, ElSheshtawy N: Genetic identification of Pseudomonas aeruginosa virulence genes among different isolates. J Microb Biochem Technol. 2015; 7(5): 274–7. Publisher Full Text

[30] 30. Mathlouthi N, Al-Bayssari C, El Salabi A, et al.: Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals. J Infect Dev Ctries. 2016; 10(7): 718–27. PubMed Abstract | Publisher Full Text

[31] 31. Saishu N, Ozaki H, Murase T: CTX-M-type extended-spectrum β-lactamase-producing Klebsiella pneumoniae isolated from cases of bovine mastitis in Japan. J Vet Med Sci. 2014; 76(8): 1153–6. PubMed Abstract | Publisher Full Text | Free Full Text

[32] 32. Hujer AM, Page MG, Helfand MS, et al.: Development of a sensitive and specific enzyme-linked immunosorbent assay for detecting and quantifying CMY-2 and SHV beta-lactamases. J Clin Microbiol. 2002; 40(6): 1947–57. PubMed Abstract | Publisher Full Text | Free Full Text

[33] 33. Liu XQ, Liu YR: Detection and genotype analysis of AmpC β-lactamase in Klebsiella pneumoniae from tertiary hospitals. Exp Ther Med. 2016; 12(1): 480–4. PubMed Abstract | Publisher Full Text | Free Full Text

[34] 34. Finlayson E, Brown P: Comparison of antibiotic resistance and virulence factors in pigmented and non-pigmented Pseudomonas aeruginosa. West Indian Med J. 2011; 60(1): 24–32. PubMed Abstract

[35] 35. Magoué CL, Melin P, Gangoue-Pieboji J, et al.: Prevalence and spread of extended-spectrum β-lactamase-producing Enterobacteriaceae in Ngaoundere, Cameroon. Clin Microbiol Infect. 2013; 19(9): E416–E20. PubMed Abstract | Publisher Full Text

[36] 36. Altayb HN, Siddig MA, El Amin NM, et al.: Molecular Characterization of CTX-M ESBLs among Pathogenic Enterobacteriaceae isolated from different regions in Sudan. 2018. Reference Source

[37] 37. Qureshi MA, Bhatnagar RK: Phenotypic Characterization of ESBL, AmpC and MBL Producers among the Clinical Isolates of Multidrug Resistant Pseudomonas aeruginosa. Int J Curr Microbiol App Sci. 2016; 5(10): 749–58. Publisher Full Text

[38] 38. Gupta R, Malik A, Rizvi M, et al.: Incidence of multidrug-resistant Pseudomonas spp. In ICU patients with special reference to ESBL, AMPC, MBL and biofilm production. J Glob Infect Dis. 2016; 8(1): 25–31. PubMed Abstract | Publisher Full Text | Free Full Text

[39] 39. Salah M, Azab M, Halaby H, et al.: Mutations in β-lactamases detected in multidrug resistant gram negative bacteria isolated from community acquired urinary tract infections in Assiut, Egypt. Afr J Microbiol Res. 2016; 10(46): 1938–43. Publisher Full Text

[40] 40. Rafiee R, Eftekhar F, Tabatabaei SA, et al.: Prevalence of extended-spectrum and metallo β-lactamase production in AmpC β-lactamase producing Pseudomonas aeruginosa isolates from burns. Jundishapur J Microbiol. 2014; 7(9): e16436. PubMed Abstract | Publisher Full Text | Free Full Text

[41] 41. Sales A, Fathi R, Mobaiyen H: Molecular Study of the Prevalence of CTX-M1, CTX-M2, CTXM3 in Pseudomonas aeruginosa Isolated from Clinical Samples in Tabriz Town, Iran. Electronic J Biol. 2017; 13(3): 253–259. Reference Source

[42] 42. Bokaeian M, Zahedani SS, Bajgiran MS, et al.: Frequency of PER, VEB, SHV, TEM and CTX-M genes in resistant strains of Pseudomonas aeruginosa producing extended spectrum β-lactamases. Jundishapur J Microbiol. 2014; 8(1): e13783. PubMed Abstract | Publisher Full Text | Free Full Text

[43] 43. Katvoravutthichai C, Boonbumrung K, Tiyawisutsri R: Prevalence of β-lactamase classes A, C, and D among clinical isolates of Pseudomonas aeruginosa from a tertiary-level hospital in Bangkok, Thailand. Genet Mol Res. 2016; 15(3). PubMed Abstract | Publisher Full Text

[44] 44. Awad A, Eltayeb I, Baraka O: Changing antibiotics prescribing practices in health centers of Khartoum State, Sudan. Eur J Clin Pharmacol. 2006; 62(2): 135–42. PubMed Abstract | Publisher Full Text

[45] 45. Ahmad M, Hassan M, Khalid A, et al.: Prevalence of extended spectrum β-lactamase and antimicrobial susceptibility pattern of clinical isolates of Pseudomonas from patients of Khyber Pakhtunkhwa, Pakistan. Biomed Res Int. 2016; 2016: 6068429. PubMed Abstract | Publisher Full Text | Free Full Text

[46] 46. Altom RB, Ahmed ST: Antimicrobial Susceptibility of Clinical Isolates of Pseudomonas aeruginosa to Aminoglycosides and Imipenem. B. Sc dissertation. Sudan University of Science and Technology. 2015.

[47] 47. Albadawi SA: Determination of Antimicrobial Susceptibility of Pseudomonas aeruginosa Isolated from Sudanese Patients. Post graduate Diploma dissertation. Sudan University of Science and Technology. 2010.

[48] 48. Basak S, Attal RO, Rajurkar M: Pseudomonas aeruginosa and newer β-lactamases: an emerging resistance threat. Infection Control-Updates: InTech. 2012. Publisher Full Text

[49] 49. Azizi H, Kheirandish F, Mirzaei M: Frequency of Extended-Spectrum Beta-Lactamase (ESBLs)-Multidrug Resistance Produced by Pseudomonas aeruginosa Isolated from Clinical Specimens in Khorramabad City, Iran. Br Microbiol Res J. 2015; 5(6): 490. Publisher Full Text

[50] 50. Bajpai T, Pandey M, Varma M, et al.: Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med. 2017; 7(1): 12–16. PubMed Abstract | Publisher Full Text | Free Full Text

[51] 51. Abdelrahman DN, Taha AA, Dafaallah MM, et al.: SPSS. figshare. Dataset. 2020. http://www.doi.org/10.6084/m9.figshare.12453287.v2

Extended spectrum β-lactamases and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study

Abstract

Keywords

Introduction

Methods

Study design

Collection and identification of bacterial strains

Antimicrobial susceptibility testing

Genotypic analysis of bacterial isolates

Table 1. Primer sequences.

Data analysis

Results

Table 2. Antimicrobial susceptibility pattern of Pseudomonas aeruginosa (n=80).

Figure 1. Frequency of Pseudomonas aeruginosa pigment producing isolates according to site of infection.

Figure 2. Frequency of Pseudomonas aeruginosa pigment producing isolates according to antimicrobial resistance.

Figure 3. Presence of extended spectrum β-lactamases (ESBLs) among Pseudomonas aeruginosa isolates site of infection.

Table 3. Number of Pseudomonas aeruginosa isolates exhibiting co-presence of two extended spectrum β-lactamases genes.

Figure 4. Presence of class C genes among Pseudomonas aeruginosa isolates and site of infection.

Figure 5. Distribution of extended spectrum β-lactamases (ESBLs) and class C β-lactamase genes among Pseudomonas aeruginosa isolates.

Table 4. Number of P. aeruginosa isolates exhibiting extended spectrum β-lactamases (ESBLs) and class C genes.

Discussion

Conclusion

Data availability

Underlying data

Acknowledgements

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated