ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study

[version 3; peer review: 2 approved]
Previously titled: Extended spectrum β-lactamases and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study
PUBLISHED 01 Apr 2021
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Pathogens gateway.

Abstract

Background: Pseudomonas aeruginosa is a pathogenic bacterium, causing nosocomial infections with  intrinsic and acquired resistance mechanisms to a large group of antibiotics, including β-lactams. This study aimed to determine the susceptibility pattern to selected antibiotics and to index the first reported β-lactamases genes frequency in Ps. aeruginosa in Khartoum State, Sudan.
Methods: 121 Ps. aeruginosa clinical isolates from various clinical specimens were used in this cross sectional study conducted in Khartoum State. Eighty isolates were confirmed as Ps. aeruginosa through conventional identification methods and species specific primers. The susceptibility pattern of the confirmed isolates to selected antibiotics was done following the Kirby Bauer disk diffusion method. Multiplex PCR was used for detection of seven β-lactamase genes (blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1, blaAmpC and blaDHA).
Results: Of the 80 confirmed Ps. aeruginosa isolates, 8 (10%) were resistant to Imipenem while all isolates were resistant to Amoxicillin and Amoxyclav (100%). A total of 43 (54%) Ps. aeruginosa isolates were positive for blaTEM, blaSHV, blaCTXM-1, blaVEB and blaOXA-1 genes, while 27 (34%) were positive for class C β- Lactamases, and 20 (25%) were positive for both classes. Frequency of beta-lactamases genes was as follows: blaTEM, 19 (44.2%); blaSHV, 16 (37.2%); bla CTX-M1, 10 (23.3%); blaVEB, 14 (32.6%); blaOXA-1, 7 (16.3%). blaAmpC 22 (81.5%) and bla DHA 8 (29.6%).  In total, 3 (11.1%) isolates were positive for both bla AmpC and blaDHA genes.
Conclusion: Ps. aeruginosa isolates showed a high rate of β- lactamases production, with co-resistance to other antibiotic classes. The lowest resistance rate of Ps. aeruginosa was to Imipenem followed by Gentamicin and Ciprofloxacin. No statistically significant relationship between production of β-lactamases in Ps. aeruginosa and resistance to third generation cephalosporins was found.

Keywords

ESBLs, class C β-lactamase, Polymerase Chain Reaction, Ps. aeruginosa, pyocyanin pigment, Khartoum-Sudan.

Revised Amendments from Version 2

Minor changes have been done following the reviewer’s comments. Changes include specifying the final included sample size, addition of results percentages to the tables with minor edits in the figures titles and in the abstract the Beta-lactamases genes naming changed according to the title.

See the authors' detailed response to the review by Nobumichi Kobayashi
See the authors' detailed response to the review by Muhammad Qasim

Introduction

Pseudomonas aeruginosa is one of the leading causes of nosocomial infections worldwide with high mortality rates, particularly among immunocompromised patients1. P. aeruginosa infections are difficult to treat, due to its extraordinary antimicrobial resistance to all available classes of antimicrobial agents2, including β-lactams, aminoglycosides and fluoroquinolones3. Resistance to β-lactams occurs by different mechanisms, including blaAmpC overexpression due to genetic mutations, mutant gene acquisition, overproduction of efflux system, or low permeability3. β-lactamases refer to enzymes that hydrolyze the amide bond of the β-lactam ring leading to drug inactivation and therapy failure4. β-lactamases are classified molecularly into four groups: class A (extended spectrum β-lactamases (ESBLs)), class B (metallo-β-lactamases), class C (cephalosporinases), and class D (oxacillinases)5.

ESBLs are enzymes that extend their hydrolyzing ability to hydrolyze broad spectrum cephalosporins6 and they also confer resistance to penicillins and narrow spectrum cephalosporins3. ESBLs are inhibited by β-lactamase inhibitors, such as clavulanic acid7. β-lactamases are transformed to ESBLs usually after point mutations in the β-lactamases gene. These mutations alter the substrate specificity because of changes in the amino acid sequences near the enzyme active site5. ESBLs producing P. aeruginosa have been reported worldwide in different countries817.

AmpC β-lactamases are class C cephalosporinases that mediate bacterial resistance to cephalosporins and cephamycins. They also exhibit low rates of monobactam, cefepime and carbapenem hydrolysis18 and usually resist the inhibition by clavulanic acid4. Normally, AmpC is a chromosomal β-lactamase gene that is regulated by ampR gene and expressed constantly. Point mutations of ampR gene in Enterobacter cloacae activate AmpC that mediate resistance to β-lactams19. In P. aeruginosa over expressed AmpC β-lactamase mediate the resistance to broad spectrum cephalosporins3. AmpC β-lactamase in P. aeruginosa has also been reported in different countries around the world2027.

The exact frequency of β-lactamase producing P. aeruginosa in Khartoum State, Sudan is unknown; therefore, the aim of this study was to determine the susceptibility pattern to selected antibiotics and to determine the frequency of β-lactamases producing P. areuginosa isolates collected in Khartoum State hospitals.

Methods

Study design

This is a cross-sectional study conducted between February 2017 and October 2017. Ethical approval for the study was obtained from the ethical committee of the College of Medical Laboratory Science, Sudan University of Science and Technology (SUST) (ethical meeting no, SUST/DSR/1EC/EA2/2017; data, 07th January 2017). Written informed consent from participants was waived by the same ethical committee as the study only used previously collected human bio-specimens with limited participant data.

Collection and identification of bacterial strains

A total of 80 ps. aeruginosa clinical isolates were obtained from Soba Teaching Hospital, Elribat University Hospital, National Laboratory for Public Health, Ear Nose Throat Hospital, and Military Hospital in Khartoum State. When there was a positive confirmation of P. aeruginosa, the study supervisor went and collected the sample from the hospital. The samples were collected from patients suffering from urinary tract infections, respiratory tract infections, blood infections, and wound and ear infections. Data pertaining to the site of infection was collected from hospital records. The bacteria were preserved in 20% glycerol and peptone water and stored at -20°C

Phenotypic identity of the isolates was confirmed through conventional bacterial identification methods, such as Gram stain, oxidase test, and reactions in media containing sugars, such as Kligler Iron Agar, urease test and, citrate test. Pigment production was assessed using Muller Hinton agar, and then phenotypic identity confirmed by genotypic characterization using multiplex PCR, as previously described1.

Antimicrobial susceptibility testing

Muller Hinton medium (HiMedia, India) was prepared and sterilized as instructed by the manufacturer. Antimicrobial susceptibility testing was performed following the modified Kirby-Bauer disc diffusion method1 and the results interpreted according to Clinical Laboratory Standards Institute guidelines (CLSI, 2007). The following antimicrobial discs (HiMedia, India) were used for sensitivity testing: Amoxicillin (25 µg), Cefotaxime (30 µg), Amoxicillin-Clavulanic acid (30 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Chloramphenicol (30 µg) and Imipenem (10 µg). P. aeruginosa ATCC 27853 was used as quality control strain to control the performance of the test and ensure that the test is properly performed.

Phenotypic identity of the isolates was confirmed through conventional bacterial identification methods such as Gram stain, oxidase test, reactions in media containing sugars such as Kligler Iron Agar, urease test and citrate test.

Genotypic analysis of bacterial isolates

Genomic DNA was extracted by simple boiling method18. The extracted DNA was used as a template for amplification of target genes using multiplex PCR using TECHNE TC-312 (UK) thermocycler. Firstly, oprI and oprL primers (Table 1) (Macrogen, Korea) were used to confirm the identification of P. aeruginosa. Seven primer pairs (Table 1) (Macrogen, Korea) were used for detection of β-lactamases genes (blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1) and class C genes (blaAmpC and blaDHA). The oprI and oprL reaction was carried out with the following cycling conditions: denaturation at 95°C for 5 min; 33 cycles of denaturation at 95°C for 30 secs, annealing at 58°C for 30 sec and extension at 72°C for 30 secs, and final extension at 72°C for 5 min28.

Table 1. Primer sequences.

Target
gene
PrimersSequences (5'-3')Product
size (bp)
References
oprIFATGAACAACGTTCTGAAATTC25029
RCTTGCGGCTGGCTTTTTCCAG
oprLFATGGAAATGCTGAAATTCGGC50029
RCTTCTTCAGCTCGACGCGACG
TEMFATGAGTATTCAACATTTCCGTG86130
RTTACCAATGCTTAATCAGTGAG
SHVFTTTATGGCGTTACCTTTGACC105030
RATTTGTCGCTCTTTACTCGC
CTXM-1FGACGATGTCACTGGCTGAGC49931
RAGCCGCCGACGCTAATACA
AmpCFATCAAAACTGGCAGCCG55032
RGAGCCCGTTTTATGGACCCA
DHAFAACTTTCACAGGTGTGCTGGGT40533
RCCGTACGCATACTGGCTTTGC
VEBFCATTCCCGATGCAAAGCGT64834
RCGAAGTTTCTTTGGACTCTG
OXA-1FGGCACCAGATTCAACTTTCAAG56435
RGACCCCAAGTTTCCTGTAAGTG

β-lactamases detection was done in two batches; the first batch was used for detection of blaTEM, blaSHV, blaCTXM-1, blaAmpC and blaDHA, while the second batch was used for detection of blaVEB and blaOXA-1 genes. The first batch detection was done in 20 µl of final reaction mixture using Maxime PCR Premix kits (iNtRON Biotechnology, Korea), containing 13 µl of double distilled water (DDW), 0.3µl of each five forward and 0.3 µl of each five reverse primers (1.5 µl), 2 µl of Dimethyl sulfoxide (DMSO) and 2 µl of template DNA.

Amplification of the second batch was done in 20µl using Maxime PCR Premix kits (iNtRON Biotechnology, Korea), containing 14.4 µl of DDW, 0.4 µl of each two forward and 0.4 µl of each two reverse primers (0.8 µl), 2 µl of DMSO and 2 µl of template DNA. Cycling conditions for both amplification reactions were as follows: initial denaturation at 94°C for 2 minutes, then 35 cycles of denaturation at 94°C for 30 secs, annealing at 54°C for 30 secs and extension at 72°C for 50 secs, and final extension at 72° for 5 minutes.

Amplified products were analyzed by electrophoreses at 80 volts for 20 minutes on 1.5% agarose gel containing ethidium bromide and then visualized using UV transilluminator (Uvitec–UK) with 50bp or 100bp molecular DNA ladder (iNtRON Biotechnology, Korea).

Data analysis

Statistical analysis of the data was performed using chi-square test (level of significance was 0.05) with SPSS software version 20 and GraphPad prism 5 demo.

Results

From 121 clinical isolates collected from different hospitals in Khartoum State, only 80 (66%) were confirmed as P. aeruginosa through conventional methods and species-specific primers; the remaining 41 (34%) isolates were considered as other Gram-negative rod bacteria. The distribution of clinical isolates according to site of infection was as follows: urine, 34 (42%); wound swab, 24 (30%); ear swab, 8 (10%); sputum, 8 (10%); and blood, 6 (7.5%).

The results of antimicrobial susceptibility test for selected antibiotics are presented in Table 2.

Table 2. Antimicrobial susceptibility pattern of Pseudomonas aeruginosa (n=80).

Antimicrobial agentSusceptible
isolates
N (%)
Resistant
isolates
N (%)
Ciprofloxacin57 (71.2)23 (28.8)
Gentamicin61 (76.2)19 (23.8)
Imipenem72 (90)8 (10.0)
Chloramphenicol9 (11.2)71 (88.8)
Amoxicillin/clavulanate080 (100)
Amoxicillin080 (100)
Ceftazidime34 (42.5)46 (57.5)
Cefotaxime9 (11.2)71 (88.8)

Out of 80 P. aeruginosa isolates, 54 (68%) were Pyocyanin pigment producers, while 26 (32%) were not pigment producers. There was a significant association between pyocyanin pigment production and site of infection (P=0.000) (Figure 1). There was also a significant association between pigment production and resistance to Chloramphenicol (P=0.020) and Cefotaxime (P=0.000), while there was insignificant association between pigment production and resistance to other antimicrobials used in this study (Figure 2).

5f658988-7ede-4ae5-a86e-aba8e09e0dd8_figure1.gif

Figure 1. Frequency of Pseudomonas aeruginosa pigment producing isolates according to site of infection.

5f658988-7ede-4ae5-a86e-aba8e09e0dd8_figure2.gif

Figure 2. Frequency of Pseudomonas aeruginosa pigment producing isolates according to antimicrobial resistance.

Molecular detection of β-lactamases showed that 43 (54%) of the isolates were positive for at least one β-lactamases gene, while 37 (46%) were negative for all genes (Figure 3). The frequency of each gene presence among P. aeruginosa was as follows: blaTEM, 19 (44.2%); blaSHV, 16 (37.2%); blaCTX-M1, 10 (23.3%); blaVEB, 14 (32.6%); and blaOXA-1, 7 (16.3%). There was a significant association between the presence of blaTEM, blaSHV, blaCTXM-1, blaVEB or blaOXA-1 genes in P. aeruginosa and site of infection (P=0.030) (Figure 3). Co-presence of more than one of blaTEM, blaSHV, blaCTXM-1, blaVEB or blaOXA-1 gene among P. aeruginosa clinical isolates is presented in Table 3.

5f658988-7ede-4ae5-a86e-aba8e09e0dd8_figure3.gif

Figure 3. Frequency of β-lactamases (blaTEM, blaSHV, blaCTXM-1, blaVEB or blaOXA-1) among Pseudomonas aeruginosa isolates site of infection.

Table 3. Number of Pseudomonas aeruginosa isolates exhibiting co-presence of blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1 β-lactamases genes.

blaTEMblaSHVblaCTXM-1blaVEBblaOXA-1
blaTEM76531
blaSHV64441
blaCTXM-154011
blaVEB34133
blaOXA-111132

Class C β-lactamases gene were positive in 27 (34%) P. aeruginosa isolates; while 53 (66%) were negative (Figure 4). The frequency of class C β-lactamases genes was as follows: blaAmpC, 22 (81.5%); blaDHA, 8 (29.6%); and 3 (11.1%) isolates were positive for both genes. Association between presence of Class C β-lactamases genes and site of infection was insignificant (P=0.215) (Figure 4).

5f658988-7ede-4ae5-a86e-aba8e09e0dd8_figure4.gif

Figure 4. Frequency of class C genes among Pseudomonas aeruginosa isolates and site of infection.

In total, 25% of P. aeruginosa isolates were positive for both β-lactamase (blaTEM, blaSHV, blaCTXM-1, blaVEB or blaOXA-1) and class C β-lactamase genes (Figure 5). Co-presence of β-lactamase genes and class C β-lactamase among P. aeruginosa clinical isolates is presented in Table 4.

5f658988-7ede-4ae5-a86e-aba8e09e0dd8_figure5.gif

Figure 5. Frequency of β-lactamases (blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1) and class C β-lactamase genes among Pseudomonas aeruginosa isolates.

Table 4. Number of P. aeruginosa isolates exhibiting β-lactamases (blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1) and class C genes.

Number
of genes
β-lactamases
n (%)
Class C
N (%)
Both classes
N (%)
Total
116 (73)6 (27)-22
27 (41)1 (16)9 (53)17
3--6 (100)6
4--5 (100)5
5--1 (100)1
6---0
7---0

Number and percentage of genes per isolate*

Discussion

Pseudomonas aeruginosa is one of the main causative agents of serious nosocomial infections with increased reports of β-lactams resistant strains that makes treatment difficult and complicated19. Production of β-lactamases is one of the most common mechanisms of β-lactam resistance36.

In this study the frequency of β-lactamases genes among P. aeruginosa isolates was 53.8%. This frequency is close to a report from India by Qureshi and Bhatnagar (2016)37, where the frequency of β-lactamases in P. aeruginosa isolates was 46%. However, the results of this study disagree with another report from India by Gupta et al. (2016)38 where the frequency of β-lactamases in P. aeruginosa isolates was 22.9%. These discrepancies could be due to differences in strains of the clinical isolates, the antibiotics used or sample size.

The most abundant gene among the β-lactamases (blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1) producing P. aeruginosa isolates detected in this study was blaTEM gene (19, 44.2%), followed by blaSHV, blaVEB, blaCTXM-1 and blaOXA-1 (16 (37.2%), 14 (32.6%), 10 (23.3%) and 7 (16.3%), respectively). Similar results were reported by Salah et al. (2016)39 in Egypt concerning the presence of blaTEM, blaSHV and blaOXA-1 (50%, 33% and 17%, respectively). The frequency of blaTEM gene is also similar to that reported by Rafiee et al. (2014)40, which was present in 39.2% of isolates. In a study in Iran by Sales et al. (2017)41, similar results were reported concerning the presence of blaCTXM-1 (27.3%), while in India Jamali et al. (2017)15 reported a higher frequency (57.5%) of this gene.

On the other hand, the frequency of blaVEB and blaSHV genes in this study differs from that reported in Iran by Bokaeian et al. (2014)42 where blaVEB gene frequency was 13.3%, while the frequency of blaSHV gene was 6.6%. The report by Jamali et al. (2017)15 concerning the genes blaTEM (15%) and blaSHV (75%) are also different from those reported in this study, and this could be due to the variation in strains of clinical isolates and the sample size used.

In this study, the frequency of class C β-lactamase genes in P. aeruginosa isolates was 27 (34%). This result is close to a report from India by Gupta et al. (2016)38 where 43% of P. aeruginosa were AmpC producers, and disagrees with a report from Thailand by Katvoravutthichai et al. (2016)43 where 11% of P. aeruginosa isolates were AmpC producers. In this study, out of the class C β- lactamase producing P. aeruginosa isolates, 22 (81.5%) and 8 (29.6%) isolates were positive for blaAmpC and blaDHA genes, respectively. Qureshi and Bhatnagar (2016)37 in India reported that no P. aeruginosa isolates were positive for blaAmpC gene, while Rafiee et al. (2014)40 in Iran reported that 60.8% of P. aeruginosa were positive for blaAmpC gene.

All P. aeruginosa clinical isolates tested in our study were resistant to Amoxicillin and Amoxicillin/clavulanate and this may be due to the misuse of antibiotics in Sudan44, where plenty of antimicrobial agents are sold over the counter. This rate of resistance is higher than the rate of resistance reported by Ahmad et al. (2016)45 in Pakistan where the resistance to Amoxicillin and Amoxicillin/clavulanate was 73.4% and 67.7% respectively, and this could be justified by the time difference between the studies, as well as the difference in the strains and antibiotics used.

The resistance rate of P. aeruginosa to Imipenem was 10% (n=8). This may be due to the infrequent use of Imipenem antibiotics. This percentage agrees with a study reported in Pakistan by Ahmad et al. (2016)45 where 11.1% of P. aeruginosa isolates were resistant to Imipenem, while in Sudan Altom and Ahmed (2015)46 reported that 5.7% P. aeruginosa isolates were resistant to Imipenem. This finding may indicate that carbapenem resistance is on the rise in P. aeruginosa isolates from Sudan.

In this study, the number of P. aeruginosa isolates resistant to Cefotaxime, Chloramphenicol and Ceftazidime was 71 (88.8%), 71 (88.8%) and 46 (57.5%), respectively. The rate of resistance to Cefotaxime in this study is different from that reported in Pakistan by Ahmad et al. (2016)45 who found that 20.3% of P. aeruginosa isolates were resistant to Ceftazidime. The resistance rate in this study also disagrees with that reported by Albadawi (2010)47 in Sudan who found that resistance of P. aeruginosa to Ceftazidime and Cefotaxime were 31% and 42%, respectively. These findings also indicate the rapidly increasing rates of P. aeruginosa resistance to antimicrobial agents in Sudan perhaps due to antibiotic misuse.

In this study, 23 (28.8%) and 19 (23.8%) of P. aeruginosa clinical isolates were resistant to Ciprofloxacin and Gentamicin, respectively. Altom and Ahmed (2015)46 in Sudan also reported that 18.6% of P. aeruginosa were resistant to Gentamicin. Different results were reported by Ahmad et al. (2016)45, where the percentage of resistance to Gentamicin and Ciprofloxacin were 74.3% and 44%, respectively. These percentages are much higher than those reported in this study probably due to their different geographical location, study time difference and the antibiotic-use rates.

In this study, there was significant association between β-lactamases production and site of infection (P=0.030). P. aeruginosa isolated from blood showed the highest production of blaTEM, blaSHV, blaCTXM-1, blaVEB and blaOXA-1 genes followed by ear swab, urine, sputum and wound swab. This result agrees with a study in India reported by Basak et al. (2012)48 where the highest β-lactamases producing P. aeruginosa isolates were from blood, but disagrees with Azizi et al. (2015)49 in Iran who found that highest production was in P. aeruginosa isolated from wound followed by urine, sputum and blood. There was insignificant association between the presence of class C β-lactamase genes and site of infection (P=0.215) found in the present study. The highest frequency of class C β-lactamases genes in P. aeruginosa were isolated from blood followed by urine, ear swab, wound swab and sputum. These results agree with the study in India reported by Basak et al. (2012)48 in that the highest percentage of class C β-lactamase genes in P. aeruginosa were found in blood.

In the present study, there were four clinical isolates phenotypically sensitive to third generation cephalosporins (Ceftazidime and Cefotaxime) and genotypically positive for β-lactamases genes. This result indicates that P. aeruginosa may carry hidden unexpressed genes that could be detected through molecular techniques. This result agrees with a study in India reported by Bajpai et al. (2017)50 where out of 38 phenotypically β-lactamases-negative isolates, 20 isolates were positive for β-lactamases genes.

In this study, the frequency of pigment producing P. aeruginosa isolates was 67.5%. In a study in India a higher percentage was reported where 82.5% of P. aeruginosa were pigment producers (Finlayson and Brown, 2011)51. The present study revealed that there was no relationship between pigment production and pattern of antimicrobial resistance, except in Chloramphenicol (P=0.02) and Cefotaxime (P=0.00).

In this study, the relationship between pigment production and site of infection was significant (P=0.000). P. aeruginosa isolated from wound infections were the highest pigment producing isolates followed by isolates from blood, urine and sputum. There was no pigment production in P. aeruginosa isolated from ear infections in this study.

The variations between the results of this study and other reports could be attributed to the difference in antibiotic usage patterns in each region, economical causes, geographical differences, sample size, differences in time in which the studies were performed, and study population. Despite the significance of the present study, there were limitations that should be avoided in future studies, such as the small sample size, phenotypic detection of β-lactamases, coverage of other β-lactamase classes, and gene sequencing should be done in order to confirm and to identify all the genes that are carried by P. aeruginosa strains in Sudan.

Conclusion

This is study is of great importance as it raises attention to the existing problem of resistance to β-lactams in P. aeruginosa in Sudan. This study confirms the reports that a number of antibiotics are becoming useless for treating this problematic bacterium, since all the strains of P. aeruginosa isolates in this study were resistant to Amoxicillin and Amoxicillin/clavulanate. The best antibiotic sensitivity results obtained in this study were those of Imipenem, followed by Gentamicin and Ciprofloxacin. Moreover, P. aeruginosa isolates showed an increased rate of β-lactamase production with co-resistance with other classes of antibiotics. Of interest is the finding that clinical isolates were resistant phenotypically in high frequencies to Amoxicillin, Amoxicillin/clavulanate and a third generation antibiotic, Cephalosporin, and showed negative results genotypically, indicating that resistance to this family of antibiotics also exist by resistance mechanisms other than β-lactamases production. Also, our PCR results revealed that P. aeruginosa possesses hidden β-lactamases genes that can’t be detected phenotypically. Finally, this study highlighted for the first time the problem of misidentification of P. aeruginosa and other microorganisms in Khartoum hospitals as only 80 out of the 120 alleged isolates were confirmed to be P. aeruginosa through PCR.

Data availability

Underlying data

Figshare: SPSS, https://doi.org/10.6084/m9.figshare.12453287.v251

This project contains the following underlying data:

  • SPSS. sav (Result sheet for beta-lactamases detection and sensitivity testing)

  • Data Dictionary. docx

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 27 Jul 2020
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Abdelrahman DN, Taha AA, Dafaallah MM et al. β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study [version 3; peer review: 2 approved]. F1000Research 2021, 9:774 (https://doi.org/10.12688/f1000research.24818.3)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 15 Sep 2020
Revised
Views
14
Cite
Reviewer Report 14 Dec 2020
Muhammad Qasim, Department of Microbiology, Kohat University of Science and Technology, Kohat, Pakistan 
Approved
VIEWS 14
The manuscript “Extended spectrum β-lactamases and class C β-lactamases gene frequency in  Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study” describe important findings on drug resistance (ESBL and Class C Beta lactamases) of P. aeruginosa ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Qasim M. Reviewer Report For: β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study [version 3; peer review: 2 approved]. F1000Research 2021, 9:774 (https://doi.org/10.5256/f1000research.29444.r74648)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 23 Dec 2020
    Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan
    23 Dec 2020
    Author Response
    Thank you for these comments, minor changes have been done following the reviewer’s comments. Changes include specifying the final included sample size, addition of results percentages to the tables with ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 23 Dec 2020
    Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan
    23 Dec 2020
    Author Response
    Thank you for these comments, minor changes have been done following the reviewer’s comments. Changes include specifying the final included sample size, addition of results percentages to the tables with ... Continue reading
Views
15
Cite
Reviewer Report 22 Sep 2020
Nobumichi Kobayashi, Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo, Japan 
Approved
VIEWS 15
The revised version is described ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kobayashi N. Reviewer Report For: β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study [version 3; peer review: 2 approved]. F1000Research 2021, 9:774 (https://doi.org/10.5256/f1000research.29444.r71387)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 27 Jul 2020
Views
26
Cite
Reviewer Report 26 Aug 2020
Nobumichi Kobayashi, Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo, Japan 
Not Approved
VIEWS 26
This is a kind of primitive study that provides only limited information. Only importance is that this study was done in Sudan. However, still number of isolates were low, and errors in descriptions of technical terms are found in this ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kobayashi N. Reviewer Report For: β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study [version 3; peer review: 2 approved]. F1000Research 2021, 9:774 (https://doi.org/10.5256/f1000research.27382.r68073)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 15 Sep 2020
    Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan
    15 Sep 2020
    Author Response
    •  Classification of bla TEM, bla SHV, bla CTXM-1, bla VEB and bla OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 15 Sep 2020
    Dina Naser, Department of Virology, Central Laboratory, Khartoum, Sudan
    15 Sep 2020
    Author Response
    •  Classification of bla TEM, bla SHV, bla CTXM-1, bla VEB and bla OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and
    ... Continue reading

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 27 Jul 2020
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.