Characterization of virulence factors and antibiotic resistance pattern of uropathogenic <i>Escherichia coli</i> strains in a tertiary care center

Naveen Kumar M; Sevitha Bhat; Archana Bhat K; Vishwas Saralaya; Shalini Shenoy Mulki

doi:10.12688/f1000research.125596.1

Home Browse Characterization of virulence factors and antibiotic resistance pattern...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Characterization of virulence factors and antibiotic resistance pattern of uropathogenic Escherichia coli strains in a tertiary care center

[version 1; peer review: 1 approved, 1 approved with reservations]

Naveen Kumar M¹, Sevitha Bhat¹, Archana Bhat K ¹, Vishwas Saralaya¹, Shalini Shenoy Mulki¹

Naveen Kumar M¹, Sevitha Bhat¹, [...] Archana Bhat K ¹, Vishwas Saralaya¹, Shalini Shenoy Mulki¹

PUBLISHED 11 Oct 2022

Author details Author details

¹ Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, Karnataka, 575001, India

Naveen Kumar M
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Sevitha Bhat
Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Project Administration, Supervision, Visualization, Writing – Review & Editing

Archana Bhat K
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Review & Editing

Vishwas Saralaya
Roles: Conceptualization, Data Curation, Methodology, Project Administration, Software, Supervision, Visualization, Writing – Review & Editing

Shalini Shenoy Mulki
Roles: Conceptualization, Methodology, Project Administration, Supervision, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Pathogens gateway.

This article is included in the Manipal Academy of Higher Education gateway.

Abstract

Background: Urinary tract infections (UTI) are the most prevalent bacterial infection in humans. The uropathogenic E. coli (UPEC) expresses a range of virulence factors that contribute to their pathogenicity. The emergence of multidrug resistance (MDR)-associated UTI is increasing. This study monitors the distribution of virulence factors among UPEC strains to note the antibiogram, outcome and type of associated UTI.
Methods: A prospective cross-sectional time-bound study of six months was done on clinically significant urinary isolates of Escherichia coli. Detection of haemolysin production and serum resistance was done by phenotypic methods. Genotypic characterization of the virulence genes (papC, iutA, hlyA, cnf1) was done by multiplex PCR. Demographic data, clinical history, antibiogram and type of UTI was collected from clinical case records.
Results:75 E.coli isolates from patients with suspected UTIs were included. Females had a higher preponderance of UTI (66.7%). 93% of patients were adults and the remaining 7% were from paediatrics. 24 (32%) isolates showed haemolysis by plate haemolysis and all isolates were serum-resistant. Out of 75 isolates, 65 were positive for at least one of four targeted genes, while remaining ten isolates were negative for all four genes. Multidrug resistance was found in 40 (53.3%) isolates. 97.4% of the UTI cases had a favourable clinical outcome at discharge. Mortality due to urosepsis was 2.6%.
Conclusion: Association of hemolysin production with resistance to imipenem and norfloxacin in UPEC strains was significant. Presence of hlyA gene is positively associated with ceftazidime resistance. Nitrofurantoin, piperacillin, tazobactam, and cefaperazone sulbactam are possible candidates for empirical therapy of UTIs. Drugs like aminoglycosides, carbapenems and fosfomycin may be used as reserve drugs in the treatment of MDR-UTI. However, inappropriate usage can increase antibiotic resistance. Hence proper selection of antibiotics in hospitals taking into account the local antibiogram is needed to reduce the emergence of antibiotic resistance.

Keywords

Virulence factors, Uropathogenic Escherichia coli, genes, antibiotic resistance, multiplex PCR

Corresponding author: Archana Bhat K

Competing interests: No competing interests were disclosed.

Grant information: The author(s) declared that no grants were involved in supporting this work.

Copyright: © 2022 Kumar M N et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Kumar M N, Bhat S, Bhat K A et al. Characterization of virulence factors and antibiotic resistance pattern of uropathogenic Escherichia coli strains in a tertiary care center [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2022, 11:1163 (https://doi.org/10.12688/f1000research.125596.1) First published: 11 Oct 2022, 11:1163 (https://doi.org/10.12688/f1000research.125596.1) Latest published: 28 Nov 2022, 11:1163 (https://doi.org/10.12688/f1000research.125596.2)

Introduction

Background: Urinary tract infections (UTI) are the most prevalent bacterial infection in humans. Every year, globally about 150 million people are diagnosed with UTI.¹ Escherichia coli, Klebsiella spp., Pseudomonas aeruginosa, Proteus mirabilis, Citrobacter spp., Staphylococcus spp., Enterococcus spp., are the most common species causing UTI. Escherichia coli is the most frequent pathogen in the human urinary tract and accounts for 75% of the UTI. 85% of the community acquired UTIs and 40% of the hospital acquired UTI are attributed to Escherichia coli.²

The term uropathogenic E. coli (UPEC) refers to the extraintestinal strains of E. coli that express a variety of virulence factors, contributing to their pathogenicity in comparison to commensal E. coli.³^,⁴ The specific virulence genes present in strains of UPEC isolates are the genes that encode adhesins (e.g. Type I fimbriae and P fimbriae), mechanisms for acquisition of nutrients (e.g. siderophores), factors that help the UPEC to escape from host defence systems (e.g. lipopolysaccharide, capsule) and toxins (e.g., cytotoxic necrotising factor 1, hemolysin).³ The factors mentioned above equip the bacteria with the ability to colonize the periurethral region, ascend the urinary tract to reach the urinary bladder resulting in infections like cystitis, urethritis, pyelonephritis, and urosepsis.⁵ UPEC strains have acquired the virulence genes (chromosomal or plasmid mediated by horizontal transfer of DNA). The molecular based platforms aid in the detection and characterization of UPEC strains.⁴ The characterization of these virulence genes in UPEC strains will help in better understanding of pathogenesis and course of UTI.

Recently there is an upsurge in UPEC strains that are multidrug-resistant (MDR), i.e., resistant to at least three or more classes of antibiotic agents.⁶ The emergence of MDR-associated UTI is increasing off late. Extended Spectrum β-Lactamase (ESBL) production among UPEC strains pose a therapeutic challenge. As a result, the therapeutic options available for the treatment of UTI are cut down which in turn is linked to treatment failure and increase in the economic burden of the community.⁷

Objectives: The study was undertaken to monitor the distribution of virulence factors among UPEC strains, to note the antibiogram, outcome, type of UTI and to look for the association of genetic virulence traits with antibiotic resistance.

Methods

Study design: Prospective cross sectional time bound study.

Study setting: The study was conducted in the Department of Microbiology, in a tertiary care center at Mangalore, India, for a duration of six months (Study period: January 2020 to May 2021).

Participants: The inclusion and exclusion criteria are as mentioned below:

Inclusion criteria: All clinically significant isolates of E.coli from urine. An isolate was considered significant if urine cultures had colony count ≥10⁵ CFU/ml or ≥10³ CFU/ml in symptomatic patients.¹

Exclusion criteria: Urine samples with no growth, less significant counts of E.coli, growth of bacteria other than E.coli, isolates of E.coli from clinical samples other than urine.

The study was conducted after approval from the Institutional Ethics Committee, Kasturba Medical College, Mangaluru (Reg No. ECR/541/Inst/KA/2014/RR-17) Reference number IECKMCMLR-12/2020/408). The study was performed on isolates retrieved in the laboratory obviating the need for informed consent from the patients.

Methodology

Specimen processing: Clean catch midstream urine samples received from suspected cases of UTI were processed within one hour of collection. The samples were inoculated onto MacConkey’s agar by semi quantitative method, Cystine-Lactose-electrolyte-deficient agar, UTI chrome agar. The culture plates were incubated for 37°C for 24 hrs. Urine samples with pure growth of E.coli, with a colony count of ≥10⁵ CFU/ml or ≥10³ CFU/ml in symptomatic patients, were considered significant. The study included 75 urinary isolates of E. coli. The isolates were identified based on colony morphology and standard biochemical tests. Antibiotic susceptibility testing was performed by the modified Kirby–Bauer disk diffusion/Vitek2 Compact (Biomerieux, France) system and interpretation was done as per the Clinical and Laboratory Standards Institute guidelines.

Variables and data source: The phenotypic methods for haemolysin production, serum resistance and genotypic characterization of virulence genes in UPEC are explained below.

Phenotypic methods for detection of haemolysin production and serum resistance:

The detection of α-haemolysin produced by E. coli was performed by plate haemolysis test. The presence of a zone of complete lysis of erythrocytes around the colony and clearing of the medium on 5% sheep blood agar, is suggestive of α-haemolysin production.⁸^,⁹

Serum resistance was studied by using fresh overnight culture of isolates as per the method described by Sharma et al.⁹ The UPEC strains were considered serum sensitive if viable count dropped to 1% of the initial value and serum resistant if ≥90% of organisms survived after 180 minutes.

Genotypic characterization of virulence genes of UPEC:³^,¹⁰

DNA extraction was performed by boiling method. The spectrum of virulence genes in UPEC strains was detected using two sets of multiplex PCR as shown below. Table 1 shows the PCR mastermix preparation used. The primer sequence of the mentioned genes is shown in Table 2. PCR was performed in a final reaction volume of 50 μl. The program for amplification included a step of initial denaturation at 95°C for 3 min, followed by 25 cycles of 94°C for 30 s, 61°C for 30 s and 68°C for 3 min and a final extension step at 72°C for 3 min. The amplicons are visualized using the gel documentation system.

Table 1. PCR mastermix preparation for set 1 and set 2 of multiplex PCR.

Set 1: PCR assay for papC and cnf1		Set 2:PCR assay for hlyA and iutA genes
Template DNA	4 μl	Template DNA	4 μl
TaKaRa Taq’s 10X buffer (100 mM Tris-HCl, pH 8.9, MgCl2 +)	5 μl	TaKaRa Taq’s 10× buffer (100 mM Tris-HCl, pH 8.9, MgCl2 +)	5 μl
dNTP (0.2 mM each)	4 μl	dNTP (0.2 mM each)	4 μl
papC primers (F and R)	1.5 μl of 0.3 μM each	hlyA primers (F and R)	3 μl of 0.6 μM each
cnf1 primers (F and R)	1.5 μl of 0.3 μM each	iutA primers (F and R)	1.5 μl of 0.3 μM each
Sterile PCR grade water	33.8 μl	Sterile PCR grade water	30.8 μl
Taq DNA polymerase	0.2 μl (1 U)	Taq DNA polymerase	0.2 μl (1 U)
Final reaction volume	50 μl	Final reaction volume	50 μl

Table 2. Primer sequence of virulence genes in UPEC strains.

Virulence factor	Target gene(s)	Primer name	Primer Sequence (5′-3′)	Size of amplicon (bp)
Pilus assembly: central region of pap operon	papC	papC-f papC-r	GTGGCAGTATGAGTAATGACCGTTA ATATCCTTTCTGCAGGGATGCAATA	200
The cytotoxic necrotizing factor I	cnf1	cnf1-F cnf1-R	AAGATGGAGTTTCCTATGCAGGAG CATTCAGAGTCCTGCCCTCATTAT T	498
α hemolysin	hlyA	hlyA-F hlyA-R	AACAAGGATAAGCACTGTTCTGGCT ACCATATAAGCGGTCATTCCCGTCA	1177
Ferric aerobactin receptor	iutA	iutA-F iutA-R	ATCGGCTGGACATCATGGGAAC CGCATTTACCGTCGGGAACGG	300

The required data was retrieved from the clinical case records and the cases of complicated and uncomplicated UTI were identified. Uncomplicated UTIs are those that occur in healthy individuals without any of the predisposing factors for UTI. Complicated UTIs occur in individuals with underlying functional or structural abnormalities of the genitourinary tract.¹¹

Sample size: The sample size was calculated taking into account the data of the previously published article (2). Using the formula $n = \frac{Z^{2} pq}{d^{2}}$ , a sample size of total 75 is calculated. Where p=prevalence=75%, q=1-p, d=Effect size=10%, Z=1.96 at 80-95% confidence interval.

The sample size for the study was 75.

Statistical analysis

All the data was entered into an excel sheet and analyzed using IBM SPSS version 25. The continuous and categorical variables have been represented as mean ± standard deviation and frequency percentages respectively. The association between the variables were analyzed using the chi-square test.

Results

A total of 75 urinary isolates of E.coli from patients with suspected urinary tract infections were included. Females had a higher preponderance of UTI (66.7%) than males (33.3%). 93% (n=70) of the patients were adults and the remaining 7%(n=5) were from paediatric population. The majority of the female patients were in the age group 20-39 years.

Phenotypic detection of serum resistance and hemolysin production exhibited by E.coli was 100% and 32% respectively. Multiplex PCR was performed for the detection of virulence genes papC, Cnf1, hlyA & iutA as shown in Figures 1 and 2. The distribution of virulence genes among the 75 UPEC isolates is as shown in Figure 3. Out of 75 isolates, 65 were positive for at least one of the four targeted genes as shown in Table 3, while the remaining ten isolates were negative for all 4 genes.

Figure 1. Multiplex PCR for papC & cnf1.

L- ladder 1000+ bp, lane 1-6: test isolates, lane 7: Negative control.

Figure 2. Multiplex PCR for hlyA & iutA.

L: ladder 1000+ bp, lane 1-7: test isolates, lane 8: Negative control.

Figure 3. Prevalence of distribution of virulence genes among the 75 UPEC isolates.

Table 3. The spectrum of virulence genes detected in UPEC isolates.

No. of virulence genes detected	Virulence genes detected	No. of isolates
4	papC, cnf1, hlyA, iutA	4
3	papC, cnf1, hlyA	6
	papC, cnf1, iutA	7
	papC, hlyA, iutA	2
	cnf1, hlyA, iutA	1
2	papC, cnf1	2
	papC, iutA	12
	cnf1, iutA	1
	hlyA, iutA	4
1	papC	5
	cnf1	1
	hlyA	2
	iutA	18
Nil	Nil	10
Total		75

It was found that hlyA gene was found in a higher percentage in haemolytic isolates (41.7%) than non- haemolytic isolates (19.6%). p-value was statistically significant (p-value=0.044). Also, 50% of the cnf1 positive isolates harboured the hlyA (haemolysin) gene (p=0.003; statistically significant).

The antibiotic resistance pattern of the UPEC isolates are as shown in Figure 4. Out of 75 isolates, 38 (50.6%) isolates were ESBL producers. Multidrug resistance (resistance to three or more antibiotic classes) was found in 40 (53.3%) isolates. Our study revealed that 45 out of the 75 urinary isolates, possessed more than one virulence factor as shown in Table 5.

Figure 4. Resistance pattern in UPEC isolates.

The distribution of virulence factors in antibiotic-resistant isolates were studied as shown in Table 4. Hemolysin production and resistance to imipenem, Norfloxacin was found to be significant (p≤0.05). The presence of hlyA gene and resistance to ceftazidime was found to be significant (p≤0.05). There was no statistically significant difference between the presence and absence of the other virulence genes with specific antibiotic resistance.

Table 4. Distribution of Virulence factors and genes in antibiotic-resistant isolate.

Virulence factors and antibiotic resistance		A	PiT	Ctr	Caz	Cfs	I	Etp	Mer	G	Ak	Nx	Cip	Fos	Nit
Haemolysin	+ve (24)	61.9% (21)	22.7% (5)	56.5% (13)	47.8% (11)	4.3% (1)	12.5%* (2)	4.8% (1)	-	21.7% (5)	4.2% (1)	19% (4)*	39.1% (9)*	4.2% (1)	4.3% (1)
Haemolysin	-ve (51)	80.9% (38)	10% (5)	66.7% (32)	34% (17)	2.1% (1)	-	-	2.1% (1)	18% (9)	-	61.7% (29)*	74% (37)*	-	2% (1)
SR	+ve (75)	75% (51)	13.9% (10)	63.4% (45)	38.4% (28)	2.9% (2)	4.3% (2)	1.4% (1)	2.1% (1)	19.2% (14)	1.4% (1)	48.5% (33)	63% (46)	1.4% (1)	2.7% (2)
papC	+ve	70.6% (24)	10.8% (4)	64.9% (24)	45.9% (17)	2.7% (1)	-	-	3.8% (1)	13.2% (5)	-	40% (14)	51.4% (19)	-	2.6% (1)
papC	-ve	79.4% (27)	19.1% (6)	61.8% (21)	30.6% (11)	3% (1)	8.7% (2)	3% (1)	-	25.7% (9)	2.9% (1)	57.6% (19)	75% (27)	2.9% (1)	2.9% (1)
Cnf1	+ve	76.2% (16)	19% (4)	68.2% (15)	47.6% (10)	-	-	-	-	27.3% (6)		33.3% (7)	47.6% (10)	-	-
Cnf1	-ve	74.5% (35)	11.8% (6)	61.2% (30)	34.6% (18)	4% (2)	6.1% (2)	2% (1)	3% (1)	15.7% (8)	2% (1)	55.3% (26)	69.2% (56)	2% (1)	3.9% (2)
hlyA	+ve	73.3% (11)	73.7% (14)	66.7% (12)	73.7% (14)*	5.3% (1)	-	-	-	26.3% (5)	-	33.3% (5)	63.2% (12)	5% (1)	-
hlyA	-ve	75.5% (40)	84.9% (45)	62.3% (33)	25.9% (14)*	2% (1)	6% (2)	2% (1)	2.8% (1)	16.7% (9)	1.9% (1)	52.8% (28)	63% (34)	-	3.8% (2)
iutA	+ve	81.4% (35)	14.9% (7)	66.7% (30)	38.3% (18)	2.1% (1)	-	-	3.2% (1)	21.3% (10)	-	57.1% (24)	63.8% (30)	2.1% (1)	-
iutA	-ve	64% (16)	12% (3)	57.7% (15)	38.5% (10)	4.3% (1)	15.4% (2)	4.2% (1)	-	15.4% (4)	3.8% (1)	34.6% (9)	61.5% (16)	-	7.7% (2)

* p≤0.05 statistically significant.

Among the 40 MDR E. coli isolates, 11 (27.5%) isolates produced haemolysis and all were serum resistant. iutA, papC, cnf1, hlyA genes were detected in 72.5% (n=29), 47.5% (n=19), 35% (n=14) and 27.5% (n=11) of the MDR isolates respectively.

Out of the total 75 cases of UPEC studied, 60% (n=45) were complicated UTI and 40% (n=30) were uncomplicated UTI. Out of the complicated UTI cases, the common genes detected were iutA (83%) and papC (50%) followed by cnf1 (33%) and hlyA (10%) genes. Among the uncomplicated UTI isolates, iutA (77%), papC (55%) and cnf1 (23%) were the common genes detected. None of the isolates from uncomplicated UTI had hlyA. 77% of the complicated UTI were MDR and 33% of the uncomplicated UTI cases were MDR.

Out of the total 75 cases of UPEC studied, majority (97.4%) had a favourable clinical outcome at discharge. Mortality due to urosepsis was noticed in two cases (2.6%).

Discussion

Urinary tract infection is one of the infectious diseases which is most prevalent amongst the people of all age groups from neonate to geriatric age group. Studies from India have reported varying prevalence rates of E.coli associated UTI- 50%-, 75%.¹² The bacterial pathogen accounting for the majority of community and hospital-acquired urinary infections is the UPEC. Depending on the virulence, these infections might range from mild uncomplicated UTI to complicated UTI.² Characterization of UPEC isolates with respect to their antibiotic resistance patterns and virulence factors, will aid in the effective management of UTI.

Our study revealed that 32% of the isolates produced haemolysin which is similar to the findings of Chhaya shah et al and Anuradha et al -25%, 28.07%, 32% & 47% respectively.¹³^,¹⁴ The exotoxin implicated in the enhanced virulence and lethality of clinical infections among UPEC strains is Alpha-hemolysin (Hly) production.¹⁵ UTIs associated with Alpha-hemolysin may be associated with extensive kidney inflammation and injury due to it’s cytotoxic nature. The majority of hlyA-positive strains were identified in patients with pyelonephritis (> 70%) compared to from patients with cystitis (31–48%), ascertaining the role of hlyA as an important virulence factor in the pathogenesis of pyelonephritis.¹⁶

Serum resistance is a property that provides a survival advantage to the bacteria. This makes UPEC resistant to killing by the alternative complement pathway in the normal human serum. Serum resistance in UPEC strains has been typically associated with pyelonephritis, cystitis and bacteraemia.⁷ In the current study, all 75 isolates showed resistance to serum bactericidal action. This is similar to the studies by Sharma et al and Shetty SK et al which reported 86.7% and 83% of serum resistance.⁹^,¹⁷ However, study by Anuradha et al revealed 51% of serum resistance.⁷ In UPEC, capsule and the O antigen are polysaccharides that contribute to virulence. The extracellular polysaccharides are antiphagocytic and inhibit complement-mediated lysis.¹⁸ All the strains in this study on UPEC showed serum resistance indicating its significant association with UTI.

In the current study, the genes coding for adherence gene (papC), Cytotoxic necrotizing factor I (cnf1), α haemolysin (hlyA) and ferric aerobactin receptor (iutA) were detected by multiplex PCR.

The virulence gene iutA, is the gene for the siderophore ferric aerobactin receptor which helps the bacterial intake of iron and this enables the survival of bacteria in an atmosphere with limited concentrations of iron (urinary tract) This gene was the commonest gene detected in the UPEC isolates of our study(65%), thus proving its association with the virulence of UPEC. This finding supports the data published by Munkhdelger et al (62.2%),¹⁹ and Karam et al (66.4%).²⁰

The rate of detection of adherence gene (papC) was 52%. This is in par with a study by Chakraborty A et al in 2017 in which nearly half of their isolates (49%) carried this gene.³ Firoozeh et al reported a lower rate of detection (34.6%) of papC gene in UPEC isolates.²¹

27% of our isolates were positive for hlyA gene which was similar to the study by Gohar et al (26%).²² A lower rate (13.6%) of hlyA gene were seen by Daniela A et al study.²³

Toxigenic strains of E.coli like necrotoxigenic E.coli-1(NTEC-1) produce Cytotoxic necrotizing factor 1 (cnf1).²⁴ Our study showed that 29%(n=33) were NTEC -1 strains harbouring the gene cnf1. The distribution of cnf1 in our study is similar to the studies by Chakraborty A et al (29.5%) and Gohar et al (30%).³^,²² NTEC -1 strains are emerging pathogens in India.²⁴ Our study revealed that 50% of the cnf1 positive isolates harboured hlyA (haemolysin) gene, which is statistically significant. The combined production of several powerful toxins (haemolysin, CNF) and co-expression of various virulence genes by NTEC strains makes them potentially aggressive pathogens.²⁴ Hence identification of these strains at an early stage, would prevent the complications associated with NTEC -1 strains.

The virulence genes studied are involved in the pathogenesis of UTI. However the absence of genes in 10 isolates (13.3%) could possibly be due to mutation of the gene Thus, a negative PCR result doesnot rule out the absence of virulence genes.

Varying spectrum and rates of antibiotic resistance have been reported among the UPEC isolates and most studies have reported that amikacin, nitrofurantoin and imipenem are highly efficacious against such strains.²⁰ In our study, a high percentage of resistance was noted to beta lactam group of antibiotics (ampicillin-75%, ceftriaxone-64.4%), fluoroquinolones (ciprofloxacin-63%, norfloxacin-50%), trimethoprim/sulfamethoxazole (49.3%). Lower rates of resistance was detected with respect to piperacillin/tazobactam(13.9%), carbapenems (ertapenem-1.4%, imipenem-6.4%), amikacin(2.7%) and nitrofurantoin (2.7%), Cefoperazone/sulbactam (2.9%) and fosfomycin (1.4%). Based on these findings, nitrofurantoin, piperacillin tazobactam and cefaperazone sulbactam maybe suitable candidates for empirical therapy of UTIs. Drugs like aminoglycosides, carbapenems and fosfomycin maybe used as reserve drugs in the management of MDR-UTI due to E. coli. These results are in par with a study which revealed that nitrofurantoin and carbapenems are suitable as empirical antibiotics in the treatment of UTIs in outpatients and fosfomycin can be used against highly resistant UPEC isolates.²⁵ However, their inappropriate usage may gradually give rise to their increase in antibiotic resistance. This accentuates the need for local hospital data compilation and antibiotic resistance analysis to devise a suitable antibiotic policy for the hospitals.

We found that 51% were ESBL producers which is similar to studies by Shoba et al (19%-59.6%) & Chhaya et al (46%).²⁶^,²⁷ In our study, 45 isolates expressed multiple virulence factors (Table 5), among which a majority (57.7%) were non ESBL producers. These results support the fact that the expression of virulence genes maybe inversely related to the presence of antibiotic resistance and ESBL production.

Table 5. Presence of multiple virulence factors in ESBL producing isolates of E.coli.

Multiple virulence factors (no. of isolates)	ESBL +	ESBL -
+ (45)	19	26
_ (30)	19	11
Total 75	38	37

The distribution of virulence factors in antibiotic-resistant isolates showed that hemolysin production is significantly associated with resistance to imipenem, norfloxacin and ciprofloxacin (p≤0.05) at par with findings of Chhaya et al.²⁷ The presence of hlyA gene is significantly associated with resistance to Ceftazidime (p≤0.05). The association of the presence of hlyA with resistance to third generation cephalosporins poses a therapeutic challenge.²⁸ No other statistically significant difference was proved between the presence or absence of the other virulence factors, with any specific antibiotic resistance.

Multidrug resistance was observed in 40 isolates (53.3%). This finding is comparable to the studies by Chhaya et al²⁷ & Hasan et al²⁹ in India, in which the prevalence of MDR E. coli was 51% and 52.9% respectively. However, this finding is in contrast to study by Munkhdelger et al²⁰ which revealed a higher rate of MDR in UPEC (93.9%).

In our study, 27.5% (n=11) MDR isolates produced haemolysis and all the 40 MDR isolates showed serum resistance. Co-existence of MDR with hemolysis or serum resistance may contribute to the increased pathogenicity and nonresponse to therapy in cases of UPEC associated UTI. In our study, iutA, papC, cnf1, hlyA genes were detected in 72.5% (n=29), 47.5% (n=19), 35% (n=14) and 27.5% (n=11) of the MDR isolates respectively. iutA was the commonest gene detected in MDR isolates. This finding supports the fact that certain virulence genes like iutA is positively associated with MDR.³⁰

Inappropriate use of broad-spectrum antibiotics, prolonged hospitalisation, poor hygiene are few major factors that contribute to increasing MDR infections. In our research, the percentage of MDR in complicated UTI was 77%; which was higher compared to uncomplicated UTI (33%). Our study supports the findings of a study by Johnson J R et al, which revealed that antibiotic resistance was higher in people with complicated UTIs than with uncomplicated UTIs.³¹

In our study, third generation cephalosporins (n=15, 37.5%), meropenem (n=12, 30%), piperacillin tazobactam (n=8, 20%) and nitrofurantoin (n=5, 12.5%) were the antibiotics used in the treatment of these MDR cases.

Out of the total 75 cases of UPEC studied, majority i.e 60% (n=45) were cases of complicated UTI. Distribution of cnf1 gene was more in complicated UTIs compared to uncomplicated UTIs. hlyA gene detected in complicated UTIs was absent in isolates from uncomplicated UTIs. This difference in results, regarding the distribution of hlyA and cnf1 genes, maybe attributed to the fact hemolysin production and cnf1 are attributed to the dysfunction of local immune response and host tissue damage. Thus, probably there is increased expression of hlyA and cnf1 in complicated UTIs. There is no significant difference in the distribution of genes associated with adhesion (papC) and iron uptake (iutA). This finding is in contrast to the study by Takahashi et al, which revealed that the prevalence of papC was more in cases of uncomplicated UTI.³²

The three isolates from patients with history of emphysematous pyelonephritis and urosepsis, were found to be positive for virulence genes papC (adherence) and cnf1 (cytotoxicity). cnf1 gene is associated with extensive tissue damage⁴ and this could have contributed to the emphysematous pyelonephritis in these three cases.

Mortality due urosepsis was noticed in two cases (2.6%). Isolates of both these cases had all the 4 genes, produced hemolysin, were serum resistant and MDR. This substantiates the contribution of hemolysin production, serum resistance and expression of the virulence genes in the increased pathogenicity of UPEC.

Limitations of the study were that the study could have been performed on a larger sample size for better characterization of UPEC and also the difference in the virulence and antimicrobial drug resistance pattern of community acquired and healthcare associated UTI could have been studied.

Conclusion

The association of hemolysin production with resistance to imipenem and norfloxacin in UPEC strains was found to be significant and the presence of hlyA gene is positively associated with ceftazidime resistance, thus posing a therapeutic challenge. Nitrofurantoin, piperacillin tazobactam, cefoperazone/sulbactam, carbapenems, fosfomycin and amikacin were the antibiotics against UPEC which showed lower rates of resistance. Hence, nitrofurantoin, piperacillin tazobactam and cefaperazone sulbactam maybe suitable candidates for empirical therapy of UTIs. Drugs like aminoglycosides, carbapenems and fosfomycin may be used as reserve drugs in the treatment of MDR-UTI. However, inappropriate usage can gradually increase antibiotic resistance. Hence, proper selection of antibiotics in hospitals taking into account the local antibiogram is needed to reduce the emergence of antibiotic resistance. The data on distribution of virulence factors and antibiotic resistance helps in planning the management strategies in UTI in our setup, thus improving patient care.

Data availability

Dryad. Characterization of virulence factors and antibiotic resistance pattern of Uropathogenic Escherichia coli strains in a tertiary care center. DOI: https://doi.org/10.5061/dryad.q83bk3jmd

The full reference for data repository provided by dryad for access prior to publication, is shared using the unique URL: https://datadryad.org/stash/share/8Jp6sXknge83XG2LQqLY0nPRVbrjSjhQvvfxYFsDPkQ.

Author contributions

1. Mr Naveen Kumar M: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, SoftwareSupervision, Validation, Visualization, Writing & Editing
2. Dr Sevitha Bhat: Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing
3. Dr Archana Bhat K - Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, ProjectAdministration, Resources, SoftwareSupervision, Validation, Visualization, Writing – Review & Editing
4. Dr Shalini Shenoy M: Conceptualization, Project Administration, Resources, Supervision, Writing – Review & Editing
5. Dr Vishwas Saralaya: Conceptualization, Project Administration, Resources, Supervision, Writing.

Acknowledgments

The authors are grateful to Manipal Academy of Higher education for the support.

References

1. Pardeshi P: Prevalence of urinary tract infections and current scenario of antibiotic susceptibility pattern of bacteria causing UTI. Indian J. Microbiol. Res. 2018; 5(3): 334–338.
2. Gaurav K, Mohan TS, Neeti M, et al.: Section: Microbiology Prevalence of Urinary Tract Infections in Elderly Patients Attending A Tertiary Care Hospital Section: Microbiology. Int. J. Contemp. Med. Res. 2019; 6(2): 16–19.
3. Chakraborty A, Adhikari P, Shenoy S, et al.: Molecular Characterisation of Uropathogenic Escherichia coli Isolates at a Tertiary Care Hospital in South India. Indian J. Med. Microbiol. 2017; 35(2): 305–310. PubMed Abstract | Publisher Full Text
4. Tarchouna M, Ferjani A, Ben-selma W, et al.: International Journal of Infectious Diseases Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Int. J. Infect. Dis. 2013; 17(6): e450–e453. PubMed Abstract | Publisher Full Text
5. Karimian A, Momtaz H, Branch S, et al.: Detection of uropathogenic Escherichia coli virulence factors in patients with urinary tract infections in Iran. Afr. J. Microbiol. Res. 2012; 6(October): 6811–6816. Publisher Full Text
6. Wolfensberger A, Kuster SP, Marchesi M, et al.: The effect of varying multidrug-resistence (MDR) definitions on rates of MDR gram- negative rods. Antimicrob. Resist. Infect. Control. 2019; 3(8): 1–9.
7. Bhrugubalda A, Penmetcha U, Yarlagadda P, et al.: A Study of Virulence Factors and Drug Resistance Pattern in Escherichia coli Isolated from Extra Intestinal Infections in a Tertiary Care Teaching. Int. J. Curr. Microbiol. App. Sci. 2016; 5(4): 140–158. Publisher Full Text
8. Article O: Phenotypic Study of Virulence Factors in Escherichia Coli Isolated From Antenatal Cases, Catheterized Patients, and Faecal Flora. J. Clin. Diagnostic Res. 2012; 6(10): 1699–1703.
9. Sharma S, Bhat GK, Shenoy S: Virulence factors and drug resistance in Escherichia coli isolated from extraintestinal infections. Indian J. Med. Microbiol. 2007; 25(4): 369–373. Publisher Full Text
10. Chakraborty A, Adhikari P, Shenoy S, et al.: Microbial Pathogenesis Molecular characterization and clinical signi fi cance of extraintestinal pathogenic Escherichia coli recovered from a south Indian tertiary care hospital. Microb. Pathog. 2016; 95: 43–48. PubMed Abstract | Publisher Full Text
11. Wagenlehner FME, Johansen TEB, Cai T, et al.: Definition and treatment of complicated urinary tract infections. Nat. Rev. Urol. 2020; 17(October): 586–600. PubMed Abstract | Publisher Full Text
12. Bhattacharyya S, Sarfraz A, Aftab M, et al.: Original Research Article Characterization and antibiogram of Uropathogenic Escherichia coli from a tertiary care hospital in Eastern India. Int. J. Curr. Microbiol. App. Sci. 2015; 4(2): 701–705.
13. Shetty AV, Kumar SH, Shekar M, et al.: Prevalence of adhesive genes among uropathogenic Escherichia coli strains isolated from patients with urinary tract infection in Mangalore.2014; 32: 175–8.
14. Shah C, Baral R, Bartaula B, Shrestha LB: Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance.2019; 1–6.
15. May AK, Gleason TG, Sawyer RG, et al.: Contribution of Escherichia coli Alpha-Hemolysin to Bacterial Virulence and to Intraperitoneal Alterations in Peritonitis. Infect. Immun. 2000; 68(1): 176–183. PubMed Abstract | Publisher Full Text | Free Full Text
16. Wang C, Li Q, Lv J, et al.: Alpha-hemolysin of uropathogenic Escherichia coli induces GM-CSF-mediated acute kidney injury. Mucosal Immunol. 2020; 13: 22–33. PubMed Abstract | Publisher Full Text
17. Shetty SK, Venkatesha DT, Rao SP, et al.: Hemolysin and Serum Resistance among ESBL Producing Extraintestinal Pathogenic Escherichia coli Isolated from a Tertiary Care Hospital.2016; 5(1): 71–77.
18. Sarkar S, Ulett GC, Totsika M, et al.: Role of Capsule and O Antigen in the Virulence of Uropathogenic Escherichia coli. PLoS One. 2014; 9(4): e94786. PubMed Abstract | Publisher Full Text
19. Munkhdelger Y, Gunregjav N, Dorjpurev A, et al.: Original Article Detection of virulence genes, phylogenetic group and antibiotic resistance of uropathogenic Escherichia coli in Mongolia. J. Infect. Dev. Ctries. 2017; 11(1): 51–57. PubMed Abstract | Publisher Full Text
20. Karam MRA, Mehri Habibi SB: Osong Public Health and Research Perspectives Relationships between Virulence Factors and Antimicrobial Resistance among Escherichia coli Isolated from Urinary Tract. Osong. Public Health Res. Perspect. 2018; 9(5): 217–224. PubMed Abstract | Publisher Full Text
21. Firoozeh F, Saffari M, Neamati F, et al.: International Journal of Infectious Diseases Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelonephritis. Int. J. Infect. Dis. 2014; 29: 219–222. PubMed Abstract | Publisher Full Text
22. Gohar NM, Aly HF, Ayoub MI: Important Virulence Factors and Related Genes in Uropathogenic E. coli and their Relation to Fluoroquinolone Resistance. J. Pure Appl. Microbiol. 2018; 12(3): 1393–1403. Publisher Full Text
23. López-banda DA, Carrillo-casas EM, Leyva-leyva M, et al.: Identification of Virulence Factors Genes in Escherichia coli Isolates from Women with Urinary Tract Infection in Mexico. Biomed. Res. Int. 2014; 2014: 1–10. PubMed Abstract | Publisher Full Text
24. Rahman H, Deka M: Detection & characterization of necrotoxin producing Escherichia coli (NTEC) from patients with urinary tract infection (UTI). Indian J. Med. Res. 2014; 139(April): 632–637.
25. Yazdanpour Z, Tadjrobehkar O: Significant association between genes encoding virulence factors with antibiotic resistance and phylogenetic groups in community acquired uropathogenic Escherichia coli isolates. BMC Microbiol. 2020; 20(241): 1–9. Publisher Full Text
26. Prasada S, Bhat A, Bhat S, et al.: Changing antibiotic susceptibility pattern in uropathogenic escherichia coli over a period of 5 years in a tertiary care center. Infect. Drug Resist. 2019; 12: 1439–1443. PubMed Abstract | Publisher Full Text
27. Shah C, Baral R, Bartaula B, et al.: Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance. BMC Microbiol. 2019; 19(204): 1–6. Publisher Full Text
28. Bischoff S, Walter T, Gerigk M, et al.: Empiric antibiotic therapy in urinary tract infection in patients with risk factors for antibiotic resistance in a German emergency department. BMC Infect. Dis. 2018; 18(56): 1–7.
29. Hasan AS, Nair D, Kaur J, et al.: Resistance Patterns Of Urinary Isolates In A Tertiary Indian Hospital. J. Ayub Med. Coll. Abbottabad. 2007; 19(1): 39–41.
30. Johnson TJ, Logue CM, Johnson JR, et al.: Associations Between Multidrug Resistance, Plasmid Content, and Virulence Potential Among Extraintestinal Pathogenic and Commensal Escherichia coli from Humans and Poultry. Foodborne Pathog. Dis. 2012; 9(1): 37–46. PubMed Abstract | Publisher Full Text
31. Johnson JR, Stell AL: Extended Virulence Genotypes of Escherichia coli Strains from Patients with Urosepsis in Relation to Phylogeny and Host Compromise.53–59.
32. Takahashi A, Kanamaru S, Kurazono H, et al.: Escherichia coli Isolates Associated with Uncomplicated and Complicated Cystitis and Asymptomatic Bacteriuria Possess Similar Phylogenies, Virulence Genes, and O-Serogroup Profiles. J. Clin. Microbiol. 2006; 44(12): 4589–4592. PubMed Abstract | Publisher Full Text

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 11 Oct 2022

Author details Author details

¹ Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, Karnataka, 575001, India

Sevitha Bhat
Roles: Conceptualization, Formal Analysis, Investigation, Methodology, Project Administration, Supervision, Visualization, Writing – Review & Editing

Vishwas Saralaya
Roles: Conceptualization, Data Curation, Methodology, Project Administration, Software, Supervision, Visualization, Writing – Review & Editing

Shalini Shenoy Mulki
Roles: Conceptualization, Methodology, Project Administration, Supervision, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

The author(s) declared that no grants were involved in supporting this work.

Article Versions (2)

version 2

Revised

Published: 28 Nov 2022, 11:1163

https://doi.org/10.12688/f1000research.125596.2

version 1

Published: 11 Oct 2022, 11:1163

https://doi.org/10.12688/f1000research.125596.1

© 2022 Kumar M N et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Kumar M N, Bhat S, Bhat K A et al. Characterization of virulence factors and antibiotic resistance pattern of uropathogenic Escherichia coli strains in a tertiary care center [version 1; peer review: 1 approved, 1 approved with reservations]. F1000Research 2022, 11:1163 (https://doi.org/10.12688/f1000research.125596.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 11 Oct 2022

Views

Reviewer Report 17 Nov 2022

Anusha Rohit, Division of Infectious Diseases, Nitte University Centre for Science Education and Research (NUCSER), Nitte (Deemed to Be University), Mangalore, Karnataka, India; The Madras Medical Mission, Chennai, India

Approved

https://doi.org/10.5256/f1000research.137922.r154567

The manuscript describes the analysis of 75 isolates of UPEC for virulence factors and antimicrobial resistance. The virulence factors and their association with resistance was also discussed. The design of the study was prospective cross-sectional.

As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?
Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?
Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.
How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Antimicrobial resistance, infection control

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Author Response 30 Nov 2022

Archana Bhat K, Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, 575001, India

30 Nov 2022

Author Response
As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were ... Continue reading
As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?

The authors have updated the discussion and conclusion in the paper . Owing to the lower rate of resistance and ease of administration, nitrofurantoin maybe an effective oral drug in outpatients with UTI (added in conclusion). However, the therapeutic utility of nitrofurantoin in complicated UTI compared to uncomplicated UTI was not studied.(added in discussion)

2. Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?

Statistical analysis (Chi square test ) for the association of the virulence factors detected and the resistance patterns of the isolates was done .The authors have added a sentence on the same. The results of significance is already mentioned in the content of discussion with reference to table 4.

3. Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.

The authors have updated the content in Background of the study-“Based on previously published literature, we aimed to look into the common genes papC and iutA and apart from them, other genes hly A and cnf1 were screened for epidemiological and virulence characterisation.”

4. How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

The authors have updated the results and added the sentence “Catheter associated UTI was seen in 33.3%(n=25) of the patients.”
As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?

The authors have updated the discussion and conclusion in the paper . Owing to the lower rate of resistance and ease of administration, nitrofurantoin maybe an effective oral drug in outpatients with UTI (added in conclusion). However, the therapeutic utility of nitrofurantoin in complicated UTI compared to uncomplicated UTI was not studied.(added in discussion)

2. Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?

Statistical analysis (Chi square test ) for the association of the virulence factors detected and the resistance patterns of the isolates was done .The authors have added a sentence on the same. The results of significance is already mentioned in the content of discussion with reference to table 4.

3. Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.

The authors have updated the content in Background of the study-“Based on previously published literature, we aimed to look into the common genes papC and iutA and apart from them, other genes hly A and cnf1 were screened for epidemiological and virulence characterisation.”

4. How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

The authors have updated the results and added the sentence “Catheter associated UTI was seen in 33.3%(n=25) of the patients.”
Competing Interests: Nil Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 30 Nov 2022

Archana Bhat K, Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, 575001, India

30 Nov 2022

Author Response
As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were ... Continue reading
As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?

The authors have updated the discussion and conclusion in the paper . Owing to the lower rate of resistance and ease of administration, nitrofurantoin maybe an effective oral drug in outpatients with UTI (added in conclusion). However, the therapeutic utility of nitrofurantoin in complicated UTI compared to uncomplicated UTI was not studied.(added in discussion)

2. Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?

Statistical analysis (Chi square test ) for the association of the virulence factors detected and the resistance patterns of the isolates was done .The authors have added a sentence on the same. The results of significance is already mentioned in the content of discussion with reference to table 4.

3. Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.

The authors have updated the content in Background of the study-“Based on previously published literature, we aimed to look into the common genes papC and iutA and apart from them, other genes hly A and cnf1 were screened for epidemiological and virulence characterisation.”

4. How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

The authors have updated the results and added the sentence “Catheter associated UTI was seen in 33.3%(n=25) of the patients.”
As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?

The authors have updated the discussion and conclusion in the paper . Owing to the lower rate of resistance and ease of administration, nitrofurantoin maybe an effective oral drug in outpatients with UTI (added in conclusion). However, the therapeutic utility of nitrofurantoin in complicated UTI compared to uncomplicated UTI was not studied.(added in discussion)

2. Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?

Statistical analysis (Chi square test ) for the association of the virulence factors detected and the resistance patterns of the isolates was done .The authors have added a sentence on the same. The results of significance is already mentioned in the content of discussion with reference to table 4.

3. Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.

The authors have updated the content in Background of the study-“Based on previously published literature, we aimed to look into the common genes papC and iutA and apart from them, other genes hly A and cnf1 were screened for epidemiological and virulence characterisation.”

4. How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

The authors have updated the results and added the sentence “Catheter associated UTI was seen in 33.3%(n=25) of the patients.”
Competing Interests: Nil Close
Report a concern

Views

Reviewer Report 31 Oct 2022

Vignesh Ramachandran, Faculty of Medicine, Universiti Kuala Lumpur-Royal College of Medicine Perak, Ipoh, Malaysia

Approved with Reservations

https://doi.org/10.5256/f1000research.137922.r153296

The authors have planned, executed, and presented an important piece of work and the information from the findings adds so much value to the medical literature. The study findings are very significant and hope a much larger study will be ... Continue reading

The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
Reference number 31 is not cited properly - need to include the journal's name.
In the methodology section, need to give a reference for the CLSI method.
The second line of the results section starts with a numeral (93%), it has to start with the text.
There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Medical Microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 30 Nov 2022

Archana Bhat K, Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, 575001, India

30 Nov 2022

Author Response

As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line ... Continue reading As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
Changes have been done in the first line of the abstract and introduction part as per reviewer suggestions.

2. The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
The references 1 and 2 have been updated.

3. Reference number 31 is not cited properly - need to include the journal's name.
The journal's name has been added and updated in references and citation.

4.In the methodology section, need to give a reference for the CLSI method.
In the methodology section, reference for the CLSI method has been cited. (Reference 8 ) References have been updated in serial order thereon.

5. The second line of the results section starts with a numeral (93%), it has to start with the text.
Modified the second line of the results section.

6. There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
Included this as a limitation of the study in the last paragraph of discussion.

7. How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results
Included this as a limitation of the study in the last paragraph of discussion.
As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
Changes have been done in the first line of the abstract and introduction part as per reviewer suggestions.

2. The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
The references 1 and 2 have been updated.

3. Reference number 31 is not cited properly - need to include the journal's name.
The journal's name has been added and updated in references and citation.

4.In the methodology section, need to give a reference for the CLSI method.
In the methodology section, reference for the CLSI method has been cited. (Reference 8 ) References have been updated in serial order thereon.

5. The second line of the results section starts with a numeral (93%), it has to start with the text.
Modified the second line of the results section.

6. There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
Included this as a limitation of the study in the last paragraph of discussion.

7. How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results
Included this as a limitation of the study in the last paragraph of discussion.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 30 Nov 2022

Archana Bhat K, Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, 575001, India

30 Nov 2022

Author Response

As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line ... Continue reading As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
Changes have been done in the first line of the abstract and introduction part as per reviewer suggestions.

2. The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
The references 1 and 2 have been updated.

3. Reference number 31 is not cited properly - need to include the journal's name.
The journal's name has been added and updated in references and citation.

4.In the methodology section, need to give a reference for the CLSI method.
In the methodology section, reference for the CLSI method has been cited. (Reference 8 ) References have been updated in serial order thereon.

5. The second line of the results section starts with a numeral (93%), it has to start with the text.
Modified the second line of the results section.

6. There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
Included this as a limitation of the study in the last paragraph of discussion.

7. How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results
Included this as a limitation of the study in the last paragraph of discussion.
As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
Changes have been done in the first line of the abstract and introduction part as per reviewer suggestions.

2. The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
The references 1 and 2 have been updated.

3. Reference number 31 is not cited properly - need to include the journal's name.
The journal's name has been added and updated in references and citation.

4.In the methodology section, need to give a reference for the CLSI method.
In the methodology section, reference for the CLSI method has been cited. (Reference 8 ) References have been updated in serial order thereon.

5. The second line of the results section starts with a numeral (93%), it has to start with the text.
Modified the second line of the results section.

6. There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
Included this as a limitation of the study in the last paragraph of discussion.

7. How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results
Included this as a limitation of the study in the last paragraph of discussion.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 2

VERSION 2 PUBLISHED 11 Oct 2022

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 2 (revision) 28 Nov 22	read
Version 1 11 Oct 22	read	read

Vignesh Ramachandran, Universiti Kuala Lumpur-Royal College of Medicine Perak, Ipoh, Malaysia
Anusha Rohit, Nitte (Deemed to Be University), Mangalore, India; The Madras Medical Mission, Chennai, India

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

8 Views

05 Dec 2022 | for Version 2

Vignesh Ramachandran, Faculty of Medicine, Universiti Kuala Lumpur-Royal College of Medicine Perak, Ipoh, Malaysia

8 Views Cite this report Responses(0)

Approved

The comments raised have been appropriately addressed in the revised manuscript.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Medical Microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

7 Views

17 Nov 2022 | for Version 1

7 Views Cite this report Responses(1)

Approved

As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?
Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?
Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.
How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Antimicrobial resistance, infection control

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (1)

Author Response

30 Nov 2022

Archana Bhat K, Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, 575001, India

As per reviewer suggestions, the following changes will be done accordingly and updated in the revised text of the manuscript and uploaded.

1. As 60% of the isolates were from complicated UTIs, can the authors explain why they suggest nitrofurantoin for therapy in the conclusion of the paper?

The authors have updated the discussion and conclusion in the paper . Owing to the lower rate of resistance and ease of administration, nitrofurantoin maybe an effective oral drug in outpatients with UTI (added in conclusion). However, the therapeutic utility of nitrofurantoin in complicated UTI compared to uncomplicated UTI was not studied.(added in discussion)

2. Was any statistical analysis done for the association of the virulence factors detected and the resistance patterns of the isolates?

Statistical analysis (Chi square test ) for the association of the virulence factors detected and the resistance patterns of the isolates was done .The authors have added a sentence on the same. The results of significance is already mentioned in the content of discussion with reference to table 4.

3. Why did the authors choose these genes for the detection of the virulence characterisation as many of these characteristics have multiple genes coding for them? The association between papC, iutA seemed to be the most common among the isolates.

The authors have updated the content in Background of the study-“Based on previously published literature, we aimed to look into the common genes papC and iutA and apart from them, other genes hly A and cnf1 were screened for epidemiological and virulence characterisation.”

4. How many of these isolates were from patients who developed CAUTI due to the presence of a urinary catheter?

The authors have updated the results and added the sentence “Catheter associated UTI was seen in 33.3%(n=25) of the patients.”

View more View less

Competing Interests

Nil

Back to all reports

Reviewer Report

15 Views

31 Oct 2022 | for Version 1

Vignesh Ramachandran, Faculty of Medicine, Universiti Kuala Lumpur-Royal College of Medicine Perak, Ipoh, Malaysia

15 Views Cite this report Responses(1)

Approved With Reservations

The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
Reference number 31 is not cited properly - need to include the journal's name.
In the methodology section, need to give a reference for the CLSI method.
The second line of the results section starts with a numeral (93%), it has to start with the text.
There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Medical Microbiology

Respond to this report

Responses (1)

Author Response

30 Nov 2022

Archana Bhat K, Department of Microbiology, Kasturba Medical College,Mangalore,Manipal academy of higher education, Manipal, Mangalore, 575001, India

As per reviewer's suggestions, the changes mentioned below will be done accordingly in the updated text file of the manuscript and submitted to the journal.

1. The first line of the abstract and introduction part begins with, "Urinary tract infections (UTI) are the most prevalent bacterial infections". This statement is too strong and needs scientific backing. It would be appropriate to say "one of the common bacterial infections".
Changes have been done in the first line of the abstract and introduction part as per reviewer suggestions.

2. The references cited in numbers one and two are not from properly indexed journals and it would be better to cite references from reputed journals.
The references 1 and 2 have been updated.

3. Reference number 31 is not cited properly - need to include the journal's name.
The journal's name has been added and updated in references and citation.

4.In the methodology section, need to give a reference for the CLSI method.
In the methodology section, reference for the CLSI method has been cited. (Reference 8 ) References have been updated in serial order thereon.

5. The second line of the results section starts with a numeral (93%), it has to start with the text.
Modified the second line of the results section.

6. There is no clear mention of the demographic characteristics of the study population. From the results, it is evident that the population is mixed including pediatrics as well as adults. It would add value to know about the study population. What if there were immunocompromised patients included and exposed to frequent antibiotics, the resistance patterns would be different in them. Moreover, the virulence characteristics are also different among those populations. How did the authors rule out other comorbidities and immune effects in the study population?
Included this as a limitation of the study in the last paragraph of discussion.

7. How many of the cases were community-acquired and how many were nosocomial? These factors have major implications in affecting the study results
Included this as a limitation of the study in the last paragraph of discussion.

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Pardeshi P: Prevalence of urinary tract infections and current scenario of antibiotic susceptibility pattern of bacteria causing UTI. Indian J. Microbiol. Res. 2018; 5(3): 334–338.

[2] 2. Gaurav K, Mohan TS, Neeti M, et al.: Section: Microbiology Prevalence of Urinary Tract Infections in Elderly Patients Attending A Tertiary Care Hospital Section: Microbiology. Int. J. Contemp. Med. Res. 2019; 6(2): 16–19.

[3] 3. Chakraborty A, Adhikari P, Shenoy S, et al.: Molecular Characterisation of Uropathogenic Escherichia coli Isolates at a Tertiary Care Hospital in South India. Indian J. Med. Microbiol. 2017; 35(2): 305–310. PubMed Abstract | Publisher Full Text

[4] 4. Tarchouna M, Ferjani A, Ben-selma W, et al.: International Journal of Infectious Diseases Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Int. J. Infect. Dis. 2013; 17(6): e450–e453. PubMed Abstract | Publisher Full Text

[5] 5. Karimian A, Momtaz H, Branch S, et al.: Detection of uropathogenic Escherichia coli virulence factors in patients with urinary tract infections in Iran. Afr. J. Microbiol. Res. 2012; 6(October): 6811–6816. Publisher Full Text

[6] 6. Wolfensberger A, Kuster SP, Marchesi M, et al.: The effect of varying multidrug-resistence (MDR) definitions on rates of MDR gram- negative rods. Antimicrob. Resist. Infect. Control. 2019; 3(8): 1–9.

[7] 7. Bhrugubalda A, Penmetcha U, Yarlagadda P, et al.: A Study of Virulence Factors and Drug Resistance Pattern in Escherichia coli Isolated from Extra Intestinal Infections in a Tertiary Care Teaching. Int. J. Curr. Microbiol. App. Sci. 2016; 5(4): 140–158. Publisher Full Text

[8] 8. Article O: Phenotypic Study of Virulence Factors in Escherichia Coli Isolated From Antenatal Cases, Catheterized Patients, and Faecal Flora. J. Clin. Diagnostic Res. 2012; 6(10): 1699–1703.

[9] 9. Sharma S, Bhat GK, Shenoy S: Virulence factors and drug resistance in Escherichia coli isolated from extraintestinal infections. Indian J. Med. Microbiol. 2007; 25(4): 369–373. Publisher Full Text

[10] 10. Chakraborty A, Adhikari P, Shenoy S, et al.: Microbial Pathogenesis Molecular characterization and clinical signi fi cance of extraintestinal pathogenic Escherichia coli recovered from a south Indian tertiary care hospital. Microb. Pathog. 2016; 95: 43–48. PubMed Abstract | Publisher Full Text

[11] 11. Wagenlehner FME, Johansen TEB, Cai T, et al.: Definition and treatment of complicated urinary tract infections. Nat. Rev. Urol. 2020; 17(October): 586–600. PubMed Abstract | Publisher Full Text

[12] 12. Bhattacharyya S, Sarfraz A, Aftab M, et al.: Original Research Article Characterization and antibiogram of Uropathogenic Escherichia coli from a tertiary care hospital in Eastern India. Int. J. Curr. Microbiol. App. Sci. 2015; 4(2): 701–705.

[13] 13. Shetty AV, Kumar SH, Shekar M, et al.: Prevalence of adhesive genes among uropathogenic Escherichia coli strains isolated from patients with urinary tract infection in Mangalore.2014; 32: 175–8.

[14] 14. Shah C, Baral R, Bartaula B, Shrestha LB: Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance.2019; 1–6.

[15] 15. May AK, Gleason TG, Sawyer RG, et al.: Contribution of Escherichia coli Alpha-Hemolysin to Bacterial Virulence and to Intraperitoneal Alterations in Peritonitis. Infect. Immun. 2000; 68(1): 176–183. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Wang C, Li Q, Lv J, et al.: Alpha-hemolysin of uropathogenic Escherichia coli induces GM-CSF-mediated acute kidney injury. Mucosal Immunol. 2020; 13: 22–33. PubMed Abstract | Publisher Full Text

[17] 17. Shetty SK, Venkatesha DT, Rao SP, et al.: Hemolysin and Serum Resistance among ESBL Producing Extraintestinal Pathogenic Escherichia coli Isolated from a Tertiary Care Hospital.2016; 5(1): 71–77.

[18] 18. Sarkar S, Ulett GC, Totsika M, et al.: Role of Capsule and O Antigen in the Virulence of Uropathogenic Escherichia coli. PLoS One. 2014; 9(4): e94786. PubMed Abstract | Publisher Full Text

[19] 19. Munkhdelger Y, Gunregjav N, Dorjpurev A, et al.: Original Article Detection of virulence genes, phylogenetic group and antibiotic resistance of uropathogenic Escherichia coli in Mongolia. J. Infect. Dev. Ctries. 2017; 11(1): 51–57. PubMed Abstract | Publisher Full Text

[20] 20. Karam MRA, Mehri Habibi SB: Osong Public Health and Research Perspectives Relationships between Virulence Factors and Antimicrobial Resistance among Escherichia coli Isolated from Urinary Tract. Osong. Public Health Res. Perspect. 2018; 9(5): 217–224. PubMed Abstract | Publisher Full Text

[21] 21. Firoozeh F, Saffari M, Neamati F, et al.: International Journal of Infectious Diseases Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelonephritis. Int. J. Infect. Dis. 2014; 29: 219–222. PubMed Abstract | Publisher Full Text

[22] 22. Gohar NM, Aly HF, Ayoub MI: Important Virulence Factors and Related Genes in Uropathogenic E. coli and their Relation to Fluoroquinolone Resistance. J. Pure Appl. Microbiol. 2018; 12(3): 1393–1403. Publisher Full Text

[23] 23. López-banda DA, Carrillo-casas EM, Leyva-leyva M, et al.: Identification of Virulence Factors Genes in Escherichia coli Isolates from Women with Urinary Tract Infection in Mexico. Biomed. Res. Int. 2014; 2014: 1–10. PubMed Abstract | Publisher Full Text

[24] 24. Rahman H, Deka M: Detection & characterization of necrotoxin producing Escherichia coli (NTEC) from patients with urinary tract infection (UTI). Indian J. Med. Res. 2014; 139(April): 632–637.

[25] 25. Yazdanpour Z, Tadjrobehkar O: Significant association between genes encoding virulence factors with antibiotic resistance and phylogenetic groups in community acquired uropathogenic Escherichia coli isolates. BMC Microbiol. 2020; 20(241): 1–9. Publisher Full Text

[26] 26. Prasada S, Bhat A, Bhat S, et al.: Changing antibiotic susceptibility pattern in uropathogenic escherichia coli over a period of 5 years in a tertiary care center. Infect. Drug Resist. 2019; 12: 1439–1443. PubMed Abstract | Publisher Full Text

[27] 27. Shah C, Baral R, Bartaula B, et al.: Virulence factors of uropathogenic Escherichia coli (UPEC) and correlation with antimicrobial resistance. BMC Microbiol. 2019; 19(204): 1–6. Publisher Full Text

[28] 28. Bischoff S, Walter T, Gerigk M, et al.: Empiric antibiotic therapy in urinary tract infection in patients with risk factors for antibiotic resistance in a German emergency department. BMC Infect. Dis. 2018; 18(56): 1–7.

[29] 29. Hasan AS, Nair D, Kaur J, et al.: Resistance Patterns Of Urinary Isolates In A Tertiary Indian Hospital. J. Ayub Med. Coll. Abbottabad. 2007; 19(1): 39–41.

[30] 30. Johnson TJ, Logue CM, Johnson JR, et al.: Associations Between Multidrug Resistance, Plasmid Content, and Virulence Potential Among Extraintestinal Pathogenic and Commensal Escherichia coli from Humans and Poultry. Foodborne Pathog. Dis. 2012; 9(1): 37–46. PubMed Abstract | Publisher Full Text

[31] 31. Johnson JR, Stell AL: Extended Virulence Genotypes of Escherichia coli Strains from Patients with Urosepsis in Relation to Phylogeny and Host Compromise.53–59.

[32] 32. Takahashi A, Kanamaru S, Kurazono H, et al.: Escherichia coli Isolates Associated with Uncomplicated and Complicated Cystitis and Asymptomatic Bacteriuria Possess Similar Phylogenies, Virulence Genes, and O-Serogroup Profiles. J. Clin. Microbiol. 2006; 44(12): 4589–4592. PubMed Abstract | Publisher Full Text

Characterization of virulence factors and antibiotic resistance pattern of uropathogenic Escherichia coli strains in a tertiary care center

Abstract

Keywords

Introduction

Methods

Methodology

Table 1. PCR mastermix preparation for set 1 and set 2 of multiplex PCR.

Table 2. Primer sequence of virulence genes in UPEC strains.

Statistical analysis

Results

Figure 1. Multiplex PCR for papC & cnf1.

Figure 2. Multiplex PCR for hlyA & iutA.

Figure 3. Prevalence of distribution of virulence genes among the 75 UPEC isolates.

Table 3. The spectrum of virulence genes detected in UPEC isolates.

Figure 4. Resistance pattern in UPEC isolates.

Table 4. Distribution of Virulence factors and genes in antibiotic-resistant isolate.

Discussion

Table 5. Presence of multiple virulence factors in ESBL producing isolates of E.coli.

Conclusion

Data availability

Author contributions

Acknowledgments

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated