Keywords
SARS-CoV-2, Diagnosis RT-qPCR, Adjuvant formulation, Primer and probe design, High performance computing
This article is included in the Emerging Diseases and Outbreaks gateway.
This article is included in the Pathogens gateway.
This article is included in the Coronavirus (COVID-19) collection.
The COVID-19 pandemic, caused by the SARS-CoV-2, can be effectively managed with diagnostic tools such as RT-qPCR. However, it can produce false-negative results due to viral mutations and RNA secondary structures from the target gene sequence.
With High Performance Computing, the complete SARS-CoV-2 genome was obtained from the GenBank/GISAID to generate consensus sequences to design primers/probes for RT-qPCR. ORF8 gene was selected, meanwhile, E and N and RNAse P were according to CDC protocol. Nasopharyngeal swab samples were collected from patients diagnosed with SARS-CoV-2. Total RNA was purified according MagMAX kit, it was used in single, and multiplex RT-qPCR. To avoid templated secondary structures, compensate nucleotide proportions and improve Ct values, a solution composed of tetraethylammonium chloride and dimethyl sulfoxide and other with corresponding to dNTPs proportions in accordance SARS-CoV-2 genome were included. Sensitivity and specificity according to Ct values were determined with the Caret package in R software.
126,576 SARS-CoV-2 genomes from January to December 2020 comprised a database. From this, a region near of 5′ ORF8 gene showed three stem-loops was used for primers/FAM-probe. 49 samples were obtained, from them, 22 were positive to gene selected regions. Interestingly, samples from October to November 2020 were positive for all regions, however, in January 2021 different results were observed in ORF8. An improvement in Ct with the adjuvant solutions was determined in all samples with others SARS-CoV-2 primers/probes, for both single and multiplex RT-qPCR. The inclusion of the denaturing solution in single RT-qPCR increased its sensitivity with respect to the commercial method, while in multiplex the opposite was generated.
Including adjuvant solutions to prevent the formation of RNA secondary structures and the adjustment of the nucleotide ratios of SARS-CoV-2 improved single and multiplex RT-qPCR for viral identification, demonstrating its potential application in health public.
SARS-CoV-2, Diagnosis RT-qPCR, Adjuvant formulation, Primer and probe design, High performance computing
The Abstract was updated and rewritten to provide clarity in the methods and results section. The description on the use of the databases for the design of the primers/probe for the ORF8 gene was expanded. In Table 1, the concentrations of the primers, probes and oligonucleotides substrate in total nmole were included. The methodology, result and discussion were included based on the calculations of sensitivity, specificity, Positive Predictive Value (PPV) and Negative Predictive Value (NPV) values for single and multiplex RT-qPCR reactions in SARS-CoV-2 are show in Table 4. The above was implemented with a script using the Caret package in the R software. Figure 2, which presented a syntax error in the primer names, was modified. In addition, the manuscript was corrected according to the comments suggested by the evaluator. Finally, the pertinent references were included in each section.
See the authors' detailed response to the review by Andrew D. Beggs
See the authors' detailed response to the review by Juan Sebastian Quintero Barbosa
On January 23, 2020, the SARS-CoV-2 virus (Coronaviridae: Betacoronavirus: Severe acute respiratory syndrome-related coronavirus) was declared a public health emergency by the World Health Organization (WHO) International Health Regulations (IHR) Emergency Committee. At the time, the global public health authorities established that the spread of SARS-CoV-2 could be prevented if every nation adopted solid strategies for rapid and accurate disease detection (WHO, 2020).
Diagnostic methods based on gene-specific primers and probes for the detection of viruses via gene amplification include quantitative real-time polymerase chain reaction (RT-qPCR) or reverse transcription loop-mediated isothermal amplification (RT-LAMP), both of which can be conducted using oropharyngeal and nasopharyngeal swabs samples from patients (Kevadiya et al., 2021). Among these, the former method is considered the most sensitive and accurate for the detection of SARS-CoV-2 and other viruses (Martín et al., 2021). This procedure could be effectively implemented due to the characterization of the viral genome, which encompasses approximately 10 genes (Zhu et al., 2020). Therefore, WHO authorized the Berlin protocol which relies on the following genes: ORF1ab, which encodes proteins that enable viral replication (Nur et al., 2015); Spike (S), which interacts with the receptor of the host’s angiotensin-converting enzyme 2 (ACE2) (Wan et al., 2020); and E, which encodes the structural envelop protein (Tahan et al., 2021). Other protocols such as the 2019-nCoV TaqMan RT-qPCR Kit authorized by the United States Centers for Disease Control and Prevention (CDC) utilize two regions of the N gene (N1-N2), which encode for the nucleocapsid phosphoprotein (Navarathna et al., 2021). Moreover, both protocols use the RNase P gene as a control to assess the efficiency of the RT-qPCR protocol (WHO, 2009).
Nevertheless, RT-qPCR-based diagnosis is conducted on a per-gene basis and therefore its widespread implementation would be both impractical and costly. Therefore, multiplex RT-qPCR (e.g., the CDC kit or combined quantification of the ORF1ab and S genes) could be implemented as a promising approach to meet the current demand for accurate and cost-efficient diagnosis (Kudo et al., 2020). Sample pooling is another approach that could increase population-wide SARS-CoV-2 diagnosis rates and has therefore been approved and implemented in several countries (Grobe et al., 2021). However, sample numbers and sampling structure may limit the implementation of this strategy (Grobe et al., 2021).
Although RT-qPCR-based SARS-CoV-2 diagnostic tools are generally considered the gold standard for disease detection, several studies have determined that this approach is prone to return false-negative results due to gene mutations (which is often the case for the E and N genes) (Hasan et al., 2021; Tahan et al., 2021) or primer dimer formation (Jaeger et al., 2021). Another factor that affects RT-qPCR efficiency is the secondary structure of the RNA to be characterized/quantified (Hammerling et al., 2020).
Although previous studies have confirmed the influence of SARS-CoV-2 RNA secondary structure on evolutionary dynamics and transcript regulation, among other factors (Andrews et al., 2021; Huston et al., 2021; Rangan et al., 2020; Wacker et al., 2020), previous studies have not established whether this phenomenon directly or indirectly affects RT-qPCR efficiency using patient-derived samples. Moreover, the effects of adjuvants such as DMSO or ammonium salts on RT-qPCR efficiency and viral detection are also largely unknown (Kovarova & Draber, 2000). Therefore, using high-performance computing (HPC), we consolidated a global repository of SARS-CoV-2 genomes published until December 2020, which we then used to select a region of the ORF8 gene for both single and multiplex RT-qPCR-based viral detection using the E gene (Berlin protocol) and the N gene (CDC protocol) as targets. Furthermore, our findings demonstrated that adjusting the TMCA-DMSO and dNTP proportions of the denaturing solutions based on the nucleotide composition of the virus eliminates the secondary RNA structures that adversely affect the reaction. The detection and diagnosis implications of our findings will be discussed below.
This study was approved by the Research Ethics Committees of the Industrial University of Santander, the Chicamocha Clinic, and the Chicamocha Clinical Laboratory (L3C) (Bucaramanga, Santander, Colombia). The study participants were patients either hospitalized-diagnosed with SARS-CoV-2 or persons that presented to the emergency room or volunteers. All participants provided written informed consent and voluntarily participated in our study. Further, all participants were kept anonymous and were informed that the present study was conducted strictly for research purposes and that its outcomes were not intended to serve as treatment or diagnosis.
Nasopharyngeal swab samples were acquired by L3C personnel. Two samples were obtained per study participant, one for clinical diagnosis, as authorized by the Ministry of Health and Social Protection of Colombia, and the other for our study. The samples were placed in Universal Transport Medium (UTM) and stored at −80°C until required for downstream analyses (Rogers et al., 2020). The samples were collected over the course of one week and then appropriately packaged according to the sanitary legislation of Colombia (Ministry of Health and Social Protection, 2020) prior to their transportation and processing. All samples were shipped to the Central Research Laboratory of the Industrial University of Santander Health Faculty (LCI-FS-UIS) and maintained at 4°C while the informed consents were processed and digitalized.
Afterwards, the samples were aliquoted in a Class II, Type A2 Biosafety Cabinet (Thermo Fisher Scientific). A total of three aliquots were obtained from each sample, including a 200-μL aliquot for total RNA extraction, which was used immediately, and two 650-μL aliquots used as backup samples, which were stored at −80°C.
Due to the appearance of mutations in several genes of the SARS-CoV-2 reference genome that could generate false negatives with the primers and probes authorized for identification by RT-qPCR. A region coding for the accessory protein ORF8 was selected, hypothesizing that it did not have a high mutation frequency. Therefore, monthly consensus sequences were generated to determine its identity pattern with respect to new genomes. Publicly available SARS-CoV-2 genome sequences were obtained from the GenBank and GISAID databases (RRID:SCR_002760; RRID:SCR_018251) (Sayers et al., 2021; Shu & McCauley, 2017). To gather data from the GenBank database, a Python script (RRID:SCR_008394) was executed in the GUANE-1 High Performance and Scientific Computing Center of the Industrial University of Santander (SC3UIS) through the Entrez Programming Utilities interface using the Biopython package (RRID:SCR_013249; RRID:SCR_007173) (Cock et al., 2009; Geer et al., 2010), whereas all GISAID data were manually downloaded. Genomes with uncharacterized regions/nucleotides were discarded using another Python script (RRID:SCR_008394), which was used to conduct monthly FASTA sequence alignments using the MAFFT software (RRID:SCR_011811) (Katoh & Standley, 2013) coupled with previously described DNA loss model parameters (Martínez-Pérez et al., 2002, 2007). The consensus sequences were generated using BioEdit version 7.2 (RRID:SCR_007361) with a 100% threshold frequency (Hall, 1999).
Using the SARS-CoV-2 (NC_045512) reference genome and consensus sequences from January to April 2020 (Zhu et al., 2020), an approximately 150-base pair (bp) region of the ORF8 gene was selected based on the secondary structure of its RNA transcript, which in turn was predicted using the algorithms proposed by Zuker (Zuker & Jacobson, 1998) via the Mflod software (RRID:SCR_001360) (Zuker, 2003). Thus, the last set containing the codons of the central region of the ORF8 gene, which encodes the secretion protein ORF8, was chosen because it allows proper viral adhesion to the host cell (Chan et al., 2020). The obtained sequence was used as a template to create primers, a TaqMan FAM-BBQ probe, and substrate oligos for RT-qPCR. The specificity of the aforementioned molecules was confirmed via GenBank BLAST analyses (RRID:SCR_004870) (Ye et al., 2006). Genes E and N from the Berlin and CDC protocols were used as controls (Biotek, 2020; Corman et al., 2020).
All molecules were synthesized by Bioneer (Korea). The primers were purified via separation on a reverse-phase cartridge, whereas the probe and substrate oligos were purified via high-performance liquid chromatography (HPLC) and polyacrylamide gel electrophoresis (PAGE), respectively. The ORF8 RT-PCR conditions were implemented as described by the Berlin protocol (Corman et al., 2020) using the aforementioned molecules coupled with the 2019-nCoV TaqMan RT-PCR Kit (Norgen Biotek Corp) developed by the CDC (Biotek, 2020).
A:T and G:C ratios were calculated based on the monthly SARS-CoV-2 consensus sequences to obtain an average for each nucleotide. These averages were then used to determine the minimum concentrations of TEA (ABCAM-USA), DMSO (Scharlab-Spain), and dNTPs (100 mM each, Promega-USA) in molecular-grade ultrapure water (Promega-USA), in addition to the MgSO4 concentration recommended by the Berlin protocol.
Total RNA extraction was conducted using the MagMAX™ Viral/Pathogen II (MVP II) Nucleic Acid Isolation Kit (2000 RXNs) (Applied Biosystems-USA) using a KingFisher Duo Prime (5400110) DNA/RNA extraction system according to the manufacturer’s instructions (Thermo Fisher Scientific-USA) (Fang et al., 2007).
RT-qPCR was conducted using the ORF8-specific primers and probe designed herein, in addition to the E (Berlin protocol) and N genes (N1-N2; CDC protocol). The RNase P gene was used as an external control, as proposed by both of the aforementioned protocols. The reactions were conducted using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Ref. 11732088; Invitrogen-USA) and the 2019-nCoV TaqMan RT-PCR Kit (Ref. TM67100; Norgen-Biotek-Canada). Each reaction for each diagnostic system was conducted in either 15- or 25-μL reaction volumes consisting of 2 μL of patient-derived purified RNA, 2× One-Step RT-PCR Master Mix, 2× nuclease-free buffer, and the respective primers/probe at the concentrations recommended by the CDC. Moreover, a denaturing stock solution was added to obtain a final concentration of 0.7% TEA, 0.2% DMSO, and 0.8 mMol MgSO4. The dNTP reagent had a final concentration of 12 mMol dATP-dTTP, 10 mMol dCTP-dGTP, and 0.8 mMol MgSO4. The reaction conditions were the following: 55°C for 15 minutes, 95°C for 3 minutes followed by 45 cycles of 95°C for 15 s and 58°C for 30 s for the SuperScript™ III One-Step RT-PCR kit; and 95°C for 3 s followed by 55°C for 20 s for the 2019-nCoV TaqMan RT-PCR kit. Fluorescence signals were quantified using a QuantStudio 1 Real-Time PCR System (No. A40427) in a 96-well 0.2 μL block (Thermo Fisher Scientific-USA).
The above-described procedure was conducted using two different Multiplex One-Step RT-qPCR protocols. In the first instance, the primers and probes for the E, ORF8, and N (N1) genes were mixed, whereas the other reaction was performed by mixing the N1 and N2 sets of the N gene. The RNase P gene was independently assessed in both cases. All reactions were performed as described above.
To calculate the sensitivity, specificity, Positive Predictive Value (PPV) and Negative Predictive Value (NPV) of each of the reactions with the single and multiplex primers used, a script was implemented in R using the Caret package to calculate the values generated by each RT-qPCR with their respective primers/probes (https://github.com/GenomicUIS/Sensitivity-specificity-PPV-and-NPV-for-SARS-CoV-2.git) (Kuhn, 2008; R Core Team 2020). Cycle threshold (Ct) was defined for each of the primers in the single reactions of each of the processed samples, where, the value of 18-35 Ct was considered true positive, Ct 35 > false positive, Ct 18 < true negative. Subsequently, the Cts values obtained were pooled and evaluated per sample. Therefore, if the result generated by a set of primers/probes was at the above-mentioned threshold, it was considered a true positive identification. Whereas, results outside the threshold were considered false negative and indeterminate. Cts were identical for multiplex RT-qPCR reactions, but the results were evaluated as a whole.
A total of 19,317 genomes were retrieved from the GenBank database from January to October 2020 based on our search criteria, whereas the GISAID database rendered 107,259 full genomes from January to December 2020. In both cases, the number of available sequences increased substantially each month. However, the frequency of base substitutions in the monthly consensus sequences for the E, ORF8, and N genes was higher in the GISAID database compared to the GenBank database (Figure 1).

The nucleotides correspond to: forward primer in green box and lower primer blue box. The Probes is in yellow box. The conceptual translation is indicated in the top of each alignment. The number indicate the nucleotide combination. The nucleotides values combination by position corresponds to international nomenclature. The nucleotide position according to SARS-CoV-2 reference genome is indicated in the lower consensus alignment.
The region of the E gene employed herein exhibited a 113 bp length, whereas the amplicons of the N1-N2 system of the N gene were 72 and 67 bp in length, respectively, all of which exhibited loop-bubble structures. Interestingly, 154 bp of the first half of the ORF8 gene presented a loop-bubble structure, which was similar to that of the other two genes. Nevertheless, the third loop of the N1 system and the second loop of the ORF8 gene were formed via four and seven canonical pairings, respectively. These structures can be considered scorpion-type primers or probes, which are often used in RT-qPCR; however, the loop-bubble structures used for these purposes are typically formed via 2–6 canonical pairings (Figure 2). Table 1 summarizes the primer sequences used in this study.

Stem and stem-bubble structures are observed in the 5' and 3' direction. The numbers represent the amount of nucleic acids used for each set and the parentheses individually delimit each primer and probe within each segment.
| Gen | Type | Code | Sequence | Total nmole | Reference |
|---|---|---|---|---|---|
| ORF8 | Primer Forward | FwO820CoV | CAYAACTGTAGCTGCATTTCAC | 24.3 | This work |
| Primer Reverse | RvO820CoV | GCACAATTCAATTAAAGGTGCTG | 21.9 | ||
| Probe | TqMO820CoV | FAM-CAACATCAACCATATGTAGTTGATGACCCGTG-BBQ | 8.7 | ||
| Substrate Oligonucleotide | TrGtO8 | CAYAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAG TCATGTACTCAACATCAACCATATGTAGTTGATGACCCGT GTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGG AGCTAGAAAATCAGCACCTTTAATTGAATTGTGC | 0.3 | ||
| E | Primer Forward | E_Sarbeco_F1 | ACAGGTACGTTAATAGTTAATAGCGT | 34.0 | (Corman et al., 2020) |
| Primer Reverse | E_Sarbeco_R1 | ATATTGCAGCAGTACGCACACA | 49.8 | ||
| Probe | E_Sarbeco_P1 | FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ | 22.5 | ||
| N | Primer Forward | 2019-nCoV_N1-F | GACCCCAAAATCAGCGAAAT | 22.5 | (Biotek, 2020) |
| Primer Reverse | 2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG | 22.5 | ||
| Probe | 2019-nCoV_N1-P | FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ | 22.5 | ||
| Primer Forward | 2019-nCoV_N2-F | TTACAAACATTGGCCGCAAA | 22.5 | ||
| Primer Reverse | 2019-nCoV_N2-R | GCGCGACATTCCGAAGAA | 22.5 | ||
| Probe | 2019-nCoV_N2-P | FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ | 22.5 | ||
| RNase P | Primer Forward | RP-F | AGATTTGGACCTGCGAGCG | 54.3 | (Corman et al., 2020) |
| Primer Reverse | RP-R | GAGCGGCTGTCTCCACAAGT | 53.2 | ||
| Probe | RP-P | FAM–TTCTGACCTGAAGGCTCTGCGCG–BHQ | 12.8 |
A total of 49 samples were collected from October 25, 2020, to January 21, 2021, of which 22 tested positive and 27 were negative. The October samples were used to confirm that the E, ORF8, and N genes could be used as effective indicators to detect SARS-CoV-2 via RT-qPCR (Table 2, Figure 3). However, given that our secondary structure and nucleotide ratio analyses indicated that the A:T ratio was always between 63% and 70% regardless of the consensus sequence, denaturing and dNTP solutions were also incorporated in these reactions (see the Methods for more details). These conditions generally improved the Ct values of the reactions compared to those of the commercial procedures; however, some exceptions were observed (Table 2, Figure 3).

RNA obtained from patients and primers and probes corresponding to the E gene (WHO), ORF8 (this study), and the N gene (N1-N2; CDC). The green, yellow, and red arrows indicate the curves generated by denaturalization (Den), the dNTP reagent, and commercial kits, respectively. The RNase P gene was used as a control.
Given that all samples were freshly acquired and never stored, we concluded that the gradual loss of amplicon systems and adjuvant solutions began in December. This was confirmed first for the E gene system, then for the N2 system, and finally for ORF8. This trend was determined using ten samples collected from December 14 to 21, 2020. The results of our experiments could be generally classified into three outcomes depending on the viral detection system: (1) the system worked following the manufacturer’s instructions with the addition of the denaturing solution (2); the system rendered positive results with the denaturing solution but negative without it; and (3) the opposite of the second outcome (Table 2).
Our analysis of the global SARS-CoV-2 mutation patterns based on the GenBank and GISAID databases indicated that most mutations began in March 2020, and subsequently increased significantly, relative to the SARS-CoV-2 reference genome (GenBank access: NC_045512.2). This trend was particularly noticeable for the quencher and forward primer sequences of the ORF8 and N genes. Moreover, the potential primer and probe combinations for each gene increased substantially starting in November according to the GISAID database and were significantly higher in December. For example, the ORF8 system and the N1 set exhibited 3.4×1011 and 1.7×1012 combinations, respectively, whereas the N2 set and E had only 1.4×105 and 32 combinations (Figure 1).
The multiplex RT-qPCR controls of systems E, ORF8, and N (N1) with the positive samples 02 and 03 rendered the expected results, which were thereafter confirmed using samples 05 and 06 obtained in October 2020. Nevertheless, using the same reaction conditions, the denaturing solution decreased the Ct values for the positive samples obtained in October but enhanced those of the samples obtained in November. In contrast, the dNTP solution had the opposite effect (Table 3, Figure 4).

The RNA samples from 6 different patients are indicated with the respective numbers. For each curve, the first number in the nomenclature indicated the top result and the second the lower result. The RNase P gene was used as a control. The arrows and nomenclature are the same as in Figure 3.
The influence of the denaturing and dNTP solutions was further confirmed using nine samples obtained from December 4 to 7, 2020, and from January 14 to 15, 2021, using the N1–N2 primers and probe as described by the CDC. A total of six samples exhibited the originally documented pattern and the three remaining samples tested negative, both in terms of curve trends and Ct values (Table 3, Figure 5). Therefore, the initial multiplex reaction effectively detected the SARS-CoV-2 virus in the nine samples obtained from January 19 to 29, 2021 (Table 3).

Primers and probes, as indicated by the CDC coupled with the denaturalization reagent. The RNA samples from 9 patients are indicated with the respective numbers. The multiplex curves corresponding to N1-N2 are indicated at the top, whereas the results corresponding to the RNase P primers and probe used as controls are indicated below. The abbreviators and nomenclature are the same as in Figure 1.
The performance of single and multiplex RT-qPCRs with the solutions used showed that single denaturing was more sensitive than the commercial solution, but the latter is 33% more specific than the former. As for the multiplex reactions, the commercial solution showed non-significant difference in sensitivity with respect to the denaturing solution. Similarly, the specificity of the single reactions was better for the commercial solution with respect to the denaturing solution, but in the multiplex reactions this difference was not evident in the detection of true negatives as both solutions yielded results of 0. dNTPs were not evaluated due to the number of positive results (Table 4).
Since the first report of the SARS-CoV-2 virus and the beginning of the pandemic, the public health authorities indicated that the spread of this disease could be prevented by implementing rapid, cost-effective, and accurate diagnostic tools that would enable the analysis of large sample volumes across the globe. Many RT-qPCR-based diagnostic kits have since been developed based on SARS-CoV-2 marker genes (Ruhan et al., 2020; Nalla et al., 2020). However, similar to the Berlin protocol (Corman et al., 2020), several of these kits require two or three consecutive reactions that must be conducted after the first results, thus prolonging the diagnosis process. Importantly, excessively long test procedures are not only an inconvenience but also pose a serious risk to patient health and promote disease dissemination.
To the best of our knowledge, our study is the first to demonstrate the use of three genes both independently or in multiplex reactions to detect the SARS-CoV-2 virus. This was achieved by combining the primers and probes for the E gene of the Berlin protocol, the N gene (N1-N2 set) of the CDC protocol, and the ORF8 gene with reagents that promote the elimination of secondary structures and compensate for the variations in the nucleotide proportions of the SARS-CoV-2 genome. More importantly, these modifications enhance the SARS-CoV-2 detection efficiency of RT-qPCR, thus rendering results in as little as 12 hours.
These achievements were largely facilitated by our HPC analyses, which allowed for full SARS-CoV-2 genome alignments and database curation in a matter of minutes or hours using publicly available sequences from the GISAID and GenBank databases dating back to the first genomic characterization of the virus up until December 31, 2020 (Zhu et al., 2020). This allowed for the design and in silico validation of RT-qPCR primers and probes for viral detection. Nevertheless, even though our database consolidated genomic sequences from across the globe, it does not reflect the true distribution and frequency of viral variants by region, as the implementation of next-generation sequencing (NGS) technologies varies widely in different countries and regions depending on infrastructure and economic factors, thus creating biases in viral variant descriptions and genomic surveillance.
Given the aforementioned considerations, the consensus sequence-based primer and probe design conducted herein were also based on genome quality and quantity, as well as the computational capacity of our HPC cluster. This enabled the analysis of gene sequences in minutes or hours, thus allowing for the evolutionary and genomic characterization of the virus.
Another benefit of our global SARS-CoV-2 genome database is that it allowed for the prediction of secondary RNA and cDNA structures associated with the amplified region, thus providing insights into the final primer and probe nucleotide distributions and concentrations. This approach also enabled the specific formulation of denaturing solutions (Kovarova & Draber, 2000) and nucleic acid synthesis to enhance RT-qPCR Ct values for different regions of the SARS-CoV-2 genome, as demonstrated in this study. All of these factors facilitate the validation of RT-qPCR-based assays and substantially decrease the likelihood of false-negative results.
The reagents and methods described herein allow for an immediate, facile, and cost-effective detection of the SARS-CoV-2 virus; which was demonstrated by comparing the Cts of the positive results used to determine sensitivity and specificity with those published for other countries (Arakawa et al., 2024; Aranha et al., 2021; Chen et al., 2022). Nevertheless, the proposed method still relied on the use of two or three SARS-CoV-2 genes in addition to the RNase P universal control in the same RT-qPCR plate to ensure viral detection accuracy. Additionally, the high mutation rates of this virus will inevitably increase detection costs and decrease test accuracy over time, as demonstrated with the December 2020 samples. Therefore, the SARS-CoV-2 genome databases must be continually updated to preserve the accuracy and applicability of our proposed procedure.
Based on our findings, we concluded that multiplex RT-qPCR is an optimal solution for the aforementioned limitations, even though the Cts used to establish sensitivity and specificity did not show a difference in some samples between commercial methods compared to the one proposed here. However, different fluorescent dyes were required to differentiate the different probes, thus increasing operating costs associated not only with the dyes themselves but also the acquisition of multiple-channel thermocyclers to detect different fluorescent signals. Despite these disadvantages, combining the detection of the E, ORF8, and N genes increases the likelihood of identifying a fluorescent signal, making SARS-CoV-2 detection more robust and reliable. In this sense, the timely and accurate detection of the virus would allow caregivers to promptly implement pertinent measures and prevent disease progression and transmission. Moreover, the RT-qPCR procedures proposed herein are highly modular, allowing health professionals to select only the gene-specific primers and probes that they deem necessary for different diagnostic needs.
Another advantage of multiplex RT-qPCR assays is that they enable the analysis of multiple samples from a single patient (Grobe et al., 2021). Specifically, preliminary studies have demonstrated that robust diagnoses can be achieved using four samples obtained at different dates. However, this requires additional monitoring (e.g., clinical records) to optimize pool design. Taken together, our findings indicate that integrating HPC, probe and primer design, denaturing and dNTP solutions, and single and multiplex RT-qPCR protocols will contribute to the timely detection of the SARS-CoV-2 virus, thus minimizing its spread.
This genomic sequence is available in GenBank:
GenBank: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome. Accession number NC_045512; https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.
GitHub: Steps to download and align genomic sequences from GenBank in the GUANE-1 supercomputer from High Performance and Scientific Computing Center of the Industrial University of Santander (SC3UIS). This software is also used for manually downloaded sequences such as GISAID. For both databases or others, the script eliminates the undetermined sequences indicated with “n” within the genome or study sequence.
https://github.com/druedaplata/bio
Zenodo: SARS-CoV-2 genomic data obtained for this study are available in: Denaturing and dNTPs reagents improve SARS-CoV-2 detection via single and multiplex RT-qPCR. https://doi.org/10.5281/zenodo.6337537 (Cadena-Caballero et al., 2022).
This project contains the following extended data:
Data are available under the terms of the Creative Commons Zero “No rights reserved” data waiver (CC0 1.0 Public domain dedication).
The authors would like to express their gratitude to the volunteers that participated in this study, as well as to the Central Research Laboratory of the Industrial University of Santander Health Faculty (LCI-FS-UIS), the Chicamocha Clinical Laboratory, the High Performance and Scientific Computing Center of the Industrial University of Santander (SC3UIS), the Vice-Rectory of Research and Extension of the Industrial University of Santander, and Ministerio de Ciencia, Tecnología e Innovación, MINCIENCIAS; invitation No. 1015, Mincienciaton. Contract 369-2020. We would also like to thank Dr. Francisco Mora at SciWrite Solutions for providing English editing.
| Views | Downloads | |
|---|---|---|
| F1000Research | - | - |
|
PubMed Central
Data from PMC are received and updated monthly.
|
- | - |
Is the work clearly and accurately presented and does it cite the current literature?
Partly
Is the study design appropriate and is the work technically sound?
Partly
Are sufficient details of methods and analysis provided to allow replication by others?
Partly
If applicable, is the statistical analysis and its interpretation appropriate?
Partly
Are all the source data underlying the results available to ensure full reproducibility?
Partly
Are the conclusions drawn adequately supported by the results?
Partly
Competing Interests: No competing interests were disclosed.
Reviewer Expertise: Virology, immunology, vaccine research, molecular biology, and experimental assay evaluation. My assessment is primarily focused on study design, methodological clarity, data interpretation, and whether the conclusions are adequately supported by the results.
Is the work clearly and accurately presented and does it cite the current literature?
Partly
Is the study design appropriate and is the work technically sound?
Yes
Are sufficient details of methods and analysis provided to allow replication by others?
Yes
If applicable, is the statistical analysis and its interpretation appropriate?
Partly
Are all the source data underlying the results available to ensure full reproducibility?
Yes
Are the conclusions drawn adequately supported by the results?
Partly
Competing Interests: No competing interests were disclosed.
Reviewer Expertise: SARS-CoV-2 genetics.
Alongside their report, reviewers assign a status to the article:
| Invited Reviewers | ||
|---|---|---|
| 1 | 2 | |
|
Version 3 (revision) 02 May 26 |
read | |
|
Version 2 (revision) 28 Mar 24 |
read | |
|
Version 1 18 Mar 22 |
read | |
Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list:
Sign up for content alerts and receive a weekly or monthly email with all newly published articles
Already registered? Sign in
The email address should be the one you originally registered with F1000.
You registered with F1000 via Google, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Google account password, please click here.
You registered with F1000 via Facebook, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Facebook account password, please click here.
If your email address is registered with us, we will email you instructions to reset your password.
If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance.
Comments on this article Comments (0)