ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article

Novel Helicobacter pylori-associated hemolysis Hp0499 and Hp1490 and its association with severity of gastritis

[version 1; peer review: 1 approved with reservations]
PUBLISHED 09 Jan 2023
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Genomics and Genetics gateway.

This article is included in the Cell & Molecular Biology gateway.

Abstract

Background: Gastritis is an inflammation of the stomach lining often caused by Helicobacter pylori infection. Among three H. pylori genes coding for hemolytic toxins, the clinical outcome of hp0499 and hp1490 is unclear. We conducted molecular and histological analyses to evaluate the correlation between these genes and gastritis severity.
Methods: We analyzed the hp0499 and hp1490 variants of 116 Indonesian samples using next generation sequencing and validated them using polymerase chain reaction (PCR). The updated Sydney system was used to grade gastritis through histological analyses. We then calculated the influence of hp0499 and hp1490 on the gastritis severity, using multivariate analysis and cagA and vacA as major H. pylori virulence factors.
Results: Two variants of each gene were identified and named hp0499-1 and -2, and hp1490-1 and -2. We noted that hp0499 expression was significantly correlated with corporal atrophy (p = 0.037). H. pylori hp1490 significantly correlated with antral acute and chronic inflammation as well as corporal density (p = 0.025, p = 0.07, p = 0.010, respectively). After adjusting for age and sex, we found that vacA s1m1 was an independent risk factor for acute antral inflammation (p = 0.032). hp1490 and vacA s1m1 were independent risk factors for chronic antral inflammation (p = 0.030 and p = 0.031, respectively).
Conclusions: We identified the variants hp0499-1 and -2 and hp1490-1 and -2 and demonstrated that hp0499 plays a significant role in the severity of corporal atrophy. Moreover, hp1490 was characterized as an independent risk factor for chronic inflammation in the antral region. Therefore, hp0499 and hp1490 are new potential targets for therapeutics.

Keywords

Helicobacter pylori, hp0499, hp1490, gastritis, infectious disease

Introduction

Gastritis is an inflammation of the stomach lining. Several factors can cause this condition, including Helicobacter pylori infection, autoimmunity, nonsteroidal anti-inflammatory drugs, bile reflux, and allergic responses. In the histological observation, inflammatory cells are present in the stomach mucosa and submucosa.1 According to the World Health Organization (WHO), gastritis affects roughly 1.8–2.1 million people worldwide each year, or 0.03% of the global population.2 The infection prevalence is high in many areas such as Africa and East Asia, with rates of 79.1% and 56.1%.3 In a study from Indonesia, approximately 46% of all patients referred for upper endoscopy had gastritis.4 According to a recent survey, dyspepsia, one of the main symptoms of gastritis, was ranked sixth among the top 10 disorders that occurred in hospitalized Indonesian patients.5 However, there are limited healthcare facilities that provide gastrointestinal endoscopy services.

H. pylori is the most frequent pathogenic cause of gastritis.6 This bacterium is strongly associated with the prevalence of gastric and duodenal ulcers, primary B-cell gastric lymphoma, gastric carcinoma, and mucosa-associated lymphoid tissue lymphoma.7 Furthermore, numerous adhesins, such as sialic acid-binding adhesin A, blood group antigen-binding adhesin A (BabA), and outer inflammatory protein A (OipA) have been found to be produced by H. pylori.8 CagA and VacA genes are groups of non-adhesin virulence factors that, alongside the adhesin groups, have a massive part in the H. pylori pathogenesis.9 In addition, low-virulence H. pylori can induce inflammation and maintain colonization ability. It is also characterized by the presence of vacA s2, agA-negative, off-type oipA, and absence of babA genes. This suggests the involvement of other virulence factors, which include the Hp0499 and Hp1490 toxins.10

The mechanism of action of Hp1490 is not known. In contrast, Hp0499 has been identified as a phospholipase A (PldA), which has enzymatic and hemolytic activity through phospholipase (PL) enzymes as the main factor, and is considered a degrading component of the mucosal barrier. Members of the PL enzymes, such as PLC, PLA1, and PLA2, are found in H. pylori. These enzymes are crucial for degrading the integrity of the gastric layers. PL enzymes hydrolyze membrane phospholipids at a specific concentration. This process induces an inflammatory response, causing gastritis.10 A mutation study in the pldA gene strongly suggested that H. pylori PLs are a critical determinant of virulence.11 Another study also stated that the high levels of PLA2 and lysolecithin in gastric juices from individuals with H. pylori infection support the hypothesis that PLA2 is involved in inflammation and mucosal damage associated with gastric ulcer formation.12

The prevalence of H. pylori infection in Indonesia is modest, ranging from 10.4% to 22.1%,13 and its virulence is low. This can be proven by the most common genotypes being the East Asian-type cagA with a 6-bp deletion in the pre-EPIYA region, as well as the jhp0562/-(1,3) gal T double-positive, dupA negative/short-type dupA, and vacA m2 and dupA negative/short-type dupA.14 Moreover, previous Indonesian studies have indicated a large variety in the prevalence and clinical manifestations of H. pylori infection between certain ethnic groups. The presence of additional virulence factors could be the cause of these disparities.15

Therefore, this study aimed to analyze and find the correlation between the sequences of hp0499 and hp1490 in the Indonesian H. pylori strains. This study also aimed to investigate hp0499 and hp1490 as potential targets for developing new gastritis treatments.

Methods

Ethical approval

Written informed consent was obtained from all patients admitted to the study. All study protocols were approved by the Ethics Committees of the Medicine Faculty, Universitas Airlangga-Dr. Soetomo Teaching Hospital, Surabaya, Indonesia (221/Panke.KKE/IX/2012), Dr. Cipto Mangunkusumo Teaching Hospital, Jakarta, Indonesia (206/112/P1/ETIK/2014), Dr. Wahidin Sudirohusodo Teaching Hospital, Makassar, Indonesia (0208/H4.8.4.5.31/PP36-KOMETIK/2015), and the Oita University Faculty of Medicine, Yufu, Japan (P-12-10). The written informed consent was obtained from all subjects involved in the study.

Study design and participants

This was an observational analytical study using a cross-sectional approach. Similar to our previous study,14 H. pylori was isolated from the tissues obtained via the corporal and antral gastric biopsies. We analyzed the hp0499 variants of 116 H. pylori DNA samples in total. We also analyzed 1172 hp1490 sequences from dyspepsia patients who underwent endoscopy in 19 different cities in Indonesia, ranging from August 2012 to March 2017, which have been studied by next-generation sequencing (NGS) and confirmed by conventional polymerase chain reaction (PCR, Figure S1, Extended data).9,1618 These data were used to exclude non-fasted patients with partial or total gastrectomy and those contraindicated for upper endoscopy.

Written informed consent was obtained from all patients. All study protocols were approved by the Ethics Committees of the Faculty of Medicine, Universitas Airlangga, Dr. Soetomo Teaching Hospital (Surabaya, Indonesia), Dr. Wahidin Sudirohusodo Teaching Hospital (Makassar, Indonesia), Dr. Cipto Mangunkusumo Teaching Hospital (Jakarta, Indonesia), and the Oita University Faculty of Medicine (Yufu, Japan). All research procedures were based on the national and institutional ethical standards of human-based experimentation and the Helsinki Declaration of 1975, as revised in 2008 and 2013.

Molecular analysis of the hp0499 and hp1490 genes

DNA was obtained from H. pylori bacteria for the molecular analysis and used to sequence hp0499 and hp1490, and the virulence factors vacA and cagA. Takara Taq DNA Polymerase and Premix were used to amplify these genes (TaKaRa Taq version 2.0, Tokyo, Japan) with different primer sets including ND5F (5′ AGGTGGATTATAACTACTATTTGCGC 3′) and ND5R (5′ CCATCCCCATAGCCGTTAAAC 3′) primers for hp0499,11 and MD8F (5′ ATG GGGAGGAATCAAGGA 3′) and MD8R (5′ TCATGCTTCATTTTCTCCCT 3′) primers for hp1490. The PCR mixture contained 2 μL DNA (100 ng/μL), 0.125 μL Takara Taq DNA Polymerase (5 unit/μL), 1 μM of each primer (previously mentioned), 2.5 μL buffer, and 17.38 μL distilled water. The reaction was submitted to a pre-denaturation at 95 °C for 2 min, followed by 34 cycles at 95 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min, and a final extension step at 72 °C for 2 min. The resulting products were analyzed by electrophoresis using a 1.5% agarose gel containing ethidium bromide. It was visualized under ultraviolet light using the imager ChemiDoc XRS+ (Bio-Rad, Hercules, California, USA). Positive hp0499 and hp1490 strains were identified by the presence of amplicons of approximately 1068 bp and 1350 bp, respectively.

Whole-genome data of 1172 hp1490 sequences that have been mentioned previously in methods and 116 new hp0499 sequences16 were used in this study to analyze the correlation between hp0499 and hp1490 sequences. Acceptable sequence data was obtained by trimming the raw FASTQ data using Trimmomatic software.19 Then, SPAdes (version 3.12)20 was used to combine the high-quality sequencing data. The BLAST tool was used for the hp0499 and hp1490 probable hemolysin gene sequences.21 After sequence alignment with other H. pylori reference strains, including the H. pylori 26695,22 the neighbor-joining method with 500 bootstrapping from the Molecular Evolutionary Genetic Analysis X program23 was used to obtain a phylogenetic tree. The homology between Hp0499 and Hp1490 amino acid sequences from these different H. pylori strains was analyzed using the Bioedit 7.2 software and the pairwise alignment method.24

Assessment of gastritis severity

Based on the updated Sydney system guidelines,25 gastritis severity was assessed using the histopathological description of the gastric mucosa inflammation for neutrophil activity, intestinal metaplasia, atrophy, inflammation, and bacterial density. Two histopathological preparations were required for each sample and were observed under a microscope at 400 ×magnification. The microscopic characteristics of each sample were observed in five different view fields and used to classify the samples as grade 0, for no acute and chronic inflammatory cells, no tissue metaplasia, no glandular atrophy, and absence of H. pylori; and as grades I, II, and III for mild, moderate, and marked/severely damaged tissues and H. pylori presence, respectively. It was ensured that the research was carried out on at least one antrum sample and one corpus sample.

Histological and immunochemistry analyses

Buffered formalin was used to fix all the biopsy samples. Paraffin was then used to embed samples for histological testing. Hematoxylin and eosin and May-Giemsa staining were used for specific sections. With that, we could assess the infiltration of monocytes or neutrophils to define the gastritis-driven mucosal damage, and the precancerous lesions to define intestinal metaplasia atrophic gastritis. These findings are further classified based on the updated Sydney system guidelines (Figure S2a-b, Extended data).25 We have also performed immunohistochemistry of all samples to increase the accuracy of H. pylori detection (Figure S2c). The specimens in this study were evaluated by an experienced pathologist (Tomohisa Uchida) who also performed similar studies in Vietnam, Myanmar, the Dominican Republic, Indonesia, and Bhutan.14

Statistical analysis

The IBM SPSS version 20.0 was used to analyze the data. The Chi-square test or Fisher’s exact test was performed to test the variables. Statistical significance was set at p < 0.05. The multivariate regression method was also performed using all determinants with p < 0.05. A multivariate logistic regression model calculated the odds ratios (OR) of clinical outcomes and H. pylori infection by age and sex. Lastly, the odds estimations were assessed using 95% confidence intervals (CI) and odds ratios.

Results

Profile of hp0499 and hp1490 among Indonesian H. pylori

In previous studies conducted at several endoscopy centers throughout Indonesia, 116 H. pylori specimens with severity diagnoses were obtained. We also acquired an additional 104 samples of hp0499 H. pylori strains and 106 samples of hp1490 H. pylori strains, with which we performed a homology test with a pairwise alignment, as sequencing limitations for hp0499 and hp1490 were common. The evolutionary correlation between the hp0499 and hp1490 sequences was constructed through phylogenetic analysis. The constructed tree showed the two main branches of hp0499 and hp1490 (Figure 1). The first upper branch of hp0499 consisted of 79 samples and one reference strain, H. pylori 26695 (Figure 1A). The hp1490 gene was clustered in two main branches (Figure 1B). The first branch comprised 73 samples, and the second contained 35 samples and the reference strain H. pylori 26695. In addition, as a reference to another study naming the two groups or variants of hp1490 was not found, the first variant was named variant hp1490-1, while the second was named variant hp1490-2.

4ffffd04-fad5-4450-a982-de63867ff4aa_figure1.gif

Figure 1. Phylogenetic tree of hp0499 and hp1490 variants in different H. pylori.

(A) hp0499 phylogenetic tree. (B) hp1490 phylogenetic tree.

Correlation between gastric mucosa status and H. pylori hp0499 and hp1490

The relationship analysis between the hp0499 and hp1490 H. pylori types and the gastric mucosal grade as well as the density of bacteria was performed (Figures 2-5). All histopathological parameters were assessed in the antrum and corpus.

4ffffd04-fad5-4450-a982-de63867ff4aa_figure2.gif

Figure 2. Association of hp0499 variants to gastric antral mucosal inflammation.

IM: Intestinal metaplasia.

4ffffd04-fad5-4450-a982-de63867ff4aa_figure3.gif

Figure 3. Association of hp0499 variants to corporal mucosal inflammation.

IM: Intestinal metaplasia.

4ffffd04-fad5-4450-a982-de63867ff4aa_figure4.gif

Figure 4. Association between the hp1490 variant to gastric antral inflammation.

IM: Intestinal metaplasia.

4ffffd04-fad5-4450-a982-de63867ff4aa_figure5.gif

Figure 5. Association between the hp1490 variant to gastric corporal inflammation.

IM: Intestinal metaplasia.

For hp0499, we found that only the atrophy parameter in the corpus was significantly associated with the hp0499 variant (p = 0.037), whereas other histopathological parameters did not show a significant correlation (Figures 2 and 3).

We analyzed hp1490 using the updated Sydney system, and the hp1490 variant was found to have a significant association with the parameters of acute and chronic antrum inflammation along with the density of H. pylori in the corpus region (p = 0.025, p = 0.07, p = 0.010, respectively). In contrast, other histopathological parameters did not show a significant correlation (Figures 4 and 5).

Correlation between cagA, vacA, hp0499, and hp1490 with the gastritis severity grade

Since we observed a significant relationship between the variance of hp0499 and hp1490 and gastric mucosal status, we performed a multivariate analysis (Table 1) including the main virulence factors of H. pylori cagA and vacA.26 In our study, we found that vacA was significantly associated with antral acute and chronic inflammation (p < 0.05). We then performed multivariate analysis by including vacA and the hp1490 variant, adjusting for age and sex. We found that vacA s1m1 was an independent risk factor for acute antral inflammation (p = 0.032), as well as for chronic antral inflammation (p = 0.031).

Table 1. Multivariate Analysis between hp1490, CagA, and VacA in terms of acute and chronic inflammatory paramaters towards antrum and hp1490.

AcuteChronic
EstimateSignificanceEstimateSignificance
hp14900.5890.2041.0120.030
vacA s1m10.9860.0320.9770.031

Discussion

Only a few researchers have examined the relationship of H. pylori hp0499 and hp1490 with the pathophysiology of H. pylori infectivity and consequent gastritis severity, as the major limitation is the availability of molecular and structural characterization of these genes. So far, there has been no population-level research on hp0499 or hp1490. In addition, previous studies could only identify particular strains that carry these genes.16 Our study showed that H. pylori isolates from Indonesia contain the hp0499 and hp1490 genes. These findings indicate that the majority of H. pylori strains contain hp0499 and hp1490, suggesting that every H. pylori strain may cause hemolysis, as hp0499 and hp1490 encode hemolytic-related toxins.21 Previous studies have shown that hemolytic activity is critical for the survival of various bacteria. This includes Listeriolysin O, a type of hemolysin produced by Listeria monocytogenes. This hemolysin type also induces the process of bacterial release from phagosomes into the cytosol. It promotes the secretion of HlyA, a hemolysin produced by Escherichia coli which has been proven to elevate pro-inflammatory cytokine levels, such as IL-6 and IL-8, during colonization and infection processess.27 However, only a limited number of studies have explained the mechanism of hemolysis caused by H. pylori and the role of the components involved in this process.

The phylogenetic analysis showed that hp0499 and hp1490 are classified into two major monophyletic groups. Due to the lack of literature on the hp0499 and hp1490 variants of H. pylori, we hypothesized that the first monophyletic group on hp0499 is a hp0499-1 variant and the second is hp0499-2, while hp1490 clades are respectively the hp1490-1 and hp1490-2 variant groups. Previously, some genotypes of H. pylori virulence genes, such as cagA, were associated with geographical regions.28 Varieties of predominant cagA types were observed in different regions, with the East Asian type being the most predominant one in Indonesia.14,16 Our data also showed similar results, with 57% of the H. pylori cagA type being East Asian samples. The remaining samples were ABB-type (16%) and Western-type (27%). The vacA profile was dominated by the s1m1 genotype, which accounted for 68% of the samples. Further studies are necessary to structurally characterize the proteins of these genes.

Our study found a significant association between hp0499 and parameters of corporal atrophy and acute inflammation, chronic antrum inflammation, and density of H. pylori in the corpus, which was significantly correlated with the hp1490 type. The exact mechanisms of these two hemolytic-associated virulence factors are still not clearly understood. Another hemolysin factor, tylA, showed a significant association with the density of the bacteria, suggesting a more prominent role in colonization rather than inflammation.29 In addition, a previous report showed that both pldA- and tlyA-negative mutants could efficiently colonize a mouse model of H. pylori. This finding suggests that hemolysin activity is significantly associated with the colonization process and subsequent pathogenic pathway activation.27 H. pylori is a unique bacterium that harbors many virulence factors in its genome. Among these virulence factors, the most widely studied are vacA and cagA. These two virulence factors are considered the golden standard or main factors needed to determine the diagnosis.30,31 In addition to these, several other virulence factors are known to play an essential part in the H. pylori pathogenesis, such as dupĀ, oipA, babA, and iceA, each one with a different role and mechanism of action.30,31

This study performed multivariate analysis between the gold standard H. pylori virulence factors cagA and vacA and acute and chronic inflammation parameters in the antrum against hp1490. The bivariate analysis showed that cagA and vacA have a significant association with acute and chronic inflammation parameters in the antrum against hp1490. This raises the suspicion that the pathophysiology of cagA and vacA is related to these bacterial types’ colonization and hemolytic processes in the stomach, as well as hp1490 type. This also demonstrates the interaction between hp1490 with cagA and vacA in the overall pathogenesis of H. pylori infection.

Despite the present study's limitation due to its small sample size, our study provides the latest profile information about hp0499 and hp1490 and their role in the H. pylori pathogenesis. Additionally, all samples were from Indonesia, which has a relatively small prevalence of gastric cancer and gastritis atrophy. Unfortunately, our results cannot be generalized to populations in other countries due to this limitation. Hence, it is necessary to analyze additional samples and broaden the current investigation to other countries with a higher prevalence of gastric cancer and gastritis. Furthermore, research on the structure, binding, and attached proteins of hp0499 and hp1490 is crucial, as well as their association with other virulence factors, also need to be studied in the near future.

Conclusions

We observed two hp0499 and hp1490 variants (hp0499-1 and -2, and hp1490-1 and -2) in the H. pylori strains from Indonesia. A significant association of hp0499 with atrophy in the corpus suggested that hp0499 plays a larger role in inflammation in the gastric mucosa. Meanwhile, hp1490 was significantly associated with acute inflammation, chronic inflammation of the antrum, and density of H. pylori bacteria in the corpus, suggesting that hp1490 contributes more to colonization rather than inflammation in the gastric mucosa.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 09 Jan 2023
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Widiana SK, Sugihartono T, Doohan D et al. Novel Helicobacter pylori-associated hemolysis Hp0499 and Hp1490 and its association with severity of gastritis [version 1; peer review: 1 approved with reservations]. F1000Research 2023, 12:22 (https://doi.org/10.12688/f1000research.122306.1)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 1
VERSION 1
PUBLISHED 09 Jan 2023
Views
12
Cite
Reviewer Report 30 Mar 2023
I Ketut Mariadi, Gastroenterohepatology Division, Department of Internal Medicine, Prof. Ngoerah General Hospital, Udayana University, Denpasar, Bali, Indonesia 
Approved with Reservations
VIEWS 12
This paper is excellent and gives an important addition to the literature. This interesting research reports new virulence factors, including the Hp0499 and Hp1490 toxins. Some improvements should be made:
  1. Some literature was published older than
... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Mariadi IK. Reviewer Report For: Novel Helicobacter pylori-associated hemolysis Hp0499 and Hp1490 and its association with severity of gastritis [version 1; peer review: 1 approved with reservations]. F1000Research 2023, 12:22 (https://doi.org/10.5256/f1000research.134279.r165206)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.

Comments on this article Comments (0)

Version 1
VERSION 1 PUBLISHED 09 Jan 2023
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.