The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence

Antibodies

All FUS antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.²¹ Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-rabbit and anti-mouse secondary antibodies are from Thermo Fisher Scientific (cat. number A21429 and A21424).

CRISPR/Cas9 genome editing

The HeLa FUS KO clone was generated with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA-Rxi-96Rv. Two guide RNAs were used to introduce a STOP codon in the FUS gene (sequence guide 1: AGGGAGUCACAAAAGCCACC, sequence guide 2: GGUACGGUGGUGUUGAUGUC).

Cell culture

Both HeLa WT and FUS KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.²² Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/mL streptomycin (Wisent cat. number 450201).

Antibody screening by Western Blot

Western Blots were performed as described in our standard operating procedure.²³ HeLa WT and FUS KO were collected in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with 1× protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 × g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western Blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Western Blots were performed with large 5-16% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual Western Blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with the HyBlot CL autoradiography films (Denville, cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.²⁴ Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 μL of phosphate-buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0,01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μL of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by two washes to remove unbound antibodies.

HeLa WT were collected in HEPES buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. One mL aliquots at 1.0 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of HEPES lysis buffer and processed for SDS-PAGE and Western Blot on a 5-16% polyacrylamide gels.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.^12–15,18 HeLa WT and FUS KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37^oC, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10ml) in PBS for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary FUS antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/mL for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40× oil objective (NA = 1.40). Analysis was done using the Zen navigation software (Zeiss). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1).