The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence

Walaa Alshalfie; Maryam Fotouhi; Riham Ayoubi; Zhipeng You; Kathleen Southern; Peter S. McPherson; Carl Laflamme; NeuroSGC/YCharOS/EDDU collaborative group

doi:10.12688/f1000research.133220.2

Home Browse The identification of high-performing antibodies for RNA-binding protein...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Data Note

Revised

The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence

[version 2; peer review: 2 approved]

Walaa Alshalfie¹^*, Maryam Fotouhi¹^*, Riham Ayoubi¹, [...] Zhipeng You², Kathleen Southern¹, Peter S. McPherson¹, Carl Laflamme ¹, NeuroSGC/YCharOS/EDDU collaborative group

Walaa Alshalfie¹^*, Maryam Fotouhi¹^*, [...] Riham Ayoubi¹, Zhipeng You², Kathleen Southern¹, Peter S. McPherson¹, Carl Laflamme ¹, NeuroSGC/YCharOS/EDDU collaborative group

^* Equal contributors

PUBLISHED 26 Jun 2023

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada
² The Neuro’s Early Drug Discovery Unit (EDDU), Structural Genomics Consortium, McGill University, Montreal, Québec, H3A 2B4, Canada

Walaa Alshalfie
Roles: Investigation, Methodology

Maryam Fotouhi
Roles: Investigation

Riham Ayoubi
Roles: Investigation, Methodology, Visualization, Writing – Review & Editing

Zhipeng You
Roles: Investigation

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Peter S. McPherson
Roles: Conceptualization, Funding Acquisition, Resources, Supervision

Carl Laflamme
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Cell & Molecular Biology gateway.

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

RNA-binding protein Fused-in Sarcoma (FUS) plays an essential role in various cellular processes. Mutations in the C-terminal domain region, where the nuclear localization signal (NLS) is located, causes the redistribution of FUS from the nucleus to the cytoplasm. In neurons, neurotoxic aggregates are formed as a result, contributing to neurogenerative diseases. Well-characterized anti-FUS antibodies would enable the reproducibility of FUS research, thereby benefiting the scientific community.
In this study, we characterized ten FUS commercial antibodies for Western Blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls.
We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs.

Keywords

Uniprot ID P35637, FUS, RNA-binding protein FUS, antibody characterization, antibody validation, Western Blot, immunoprecipitation, immunofluorescence

Corresponding author: Carl Laflamme

Competing interests: For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems -Thermo Fisher Scientific.

Grant information: This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship.

Copyright: © 2023 Alshalfie W et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Alshalfie W, Fotouhi M, Ayoubi R et al. The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2023, 12:376 (https://doi.org/10.12688/f1000research.133220.2) First published: 06 Apr 2023, 12:376 (https://doi.org/10.12688/f1000research.133220.1) Latest published: 24 Sep 2024, 12:376 (https://doi.org/10.12688/f1000research.133220.3)

Revised Amendments from Version 1

To the introduction, we included frontotemporal local degeneration (FTLD) to the list of neurodegenerative diseases that the FUS gene may contribute to.

See the authors' detailed response to the review by Ryota Hikiami

Introduction

Fused-in Sarcoma (FUS) encodes a DNA/RNA-binding protein involved in numerous cellular processes including transcriptional regulation, RNA splicing, RNA transport and DNA repair.¹ Predominantly localized in the nucleus, FUS can shuttle between the nucleus and cytoplasm.² The FUS transcript is reported to have multiple domains including an N-terminal Gln-Gly-Ser-Tyr -rich region, an RNA-recognition motif, Arg-Gly-Gly repeat regions, a zinc finger motif and a highly conserved C-terminal NLS.³^–⁵

Variants in the FUS gene have been identified as potential causative factors for amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD) and frontotemporal lobar degeneration (FTLD).⁶^–⁹ FUS related mutations found in familial ALS/FTD patients are clustered in the C-terminal NLS, causing FUS to be mislocalized and accumulate as aggregates in the cytoplasm of neurons, initiating a pathway that contributes to neurodegeneration.⁶^,⁷ FUS function is reduced when aggregates form, but it is not yet known whether this initiates the pathogenic process or if the aggregates are pathogenic.¹⁰ Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies.

Here, we compared the performance of a range of commercially-available antibodies for RNA-binding protein FUS and validated several antibodies for Western Blot, immunoprecipitation and immunofluorescence, enabling biochemical and cellular assessment of FUS properties and function.

Results and discussion

Our standard protocol involves comparing readouts from wild-type (WT) and knockout (KO) cells.¹¹^–¹⁵ To identify a cell line that expresses adequate levels of FUS protein to provide sufficient signal to noise, we examined public proteomics databases, namely PaxDB¹⁶ and DepMap.¹⁷ HeLa was identified as a suitable cell line and thus HeLa was modified with CRISPR/Cas9 to knockout the corresponding FUS gene (Table 1).

Table 1. Summary of the cell lines used.

Institution	Catalog number	RRID (Cellosaurus)	Cell line	Genotype
ATCC	CCL-2	CVCL_0030	HeLa	WT
Montreal Neurological Institute	-	CVCL_A8VH	HeLa	FUS KO

For Western Blot experiments, we resolved proteins from WT and FUS KO cell extracts and probed them side-by-side with all antibodies in parallel¹²^–¹⁵ (Figure 1).

Figure 1. FUS antibody screening by Western Blot.

Lysates of HeLa (WT and FUS KO) were prepared and 30 μg of protein were processed for Western Blot with the indicated FUS antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. An exception was given for antibody GTX101810, which was titrated to 1/3000, as the signal was too weak when following the supplier’s recommendation. Antibody dilution used: NBP2-52874* at 1/1000; GTX101810 at 1/3000; GTX01039* at 1/1000; 60160-1-Ig* at 1/10000; 11570-1-AP at 1/4000; MA3-089* at 1/2000; MA5-32483** at 1/1000, ab124923** at 1/5000; ab154141* at 1/1000; ab243880** at 1/1000. Predicted band size: 53 kDa. Observed specific band size: ~70 kDa. *Monoclonal antibody; **Recombinant antibody.

For immunoprecipitation experiments, we used the antibodies to immunopurify FUS from HeLa cell extracts. The performance of each antibody was evaluated by detecting the FUS protein in extracts, in the immunodepleted extracts and in the immunoprecipitates¹²^–¹⁵ (Figure 2).

Figure 2. FUS antibody screening by immunoprecipitation.

HeLa lysates were prepared, and IP was performed using 1.0 μg of the indicated FUS antibodies pre-coupled to protein G or protein A Sepharose beads. Samples were washed and processed for Western Blot with the indicated FUS antibody. For Western Blot, NBP2-52874* and ab243880** were used at a dilution of 1/2000. The Ponceau stained transfers of each blot are shown for similar reasons as in Figure 1. SM=10% starting material; UB=10% unbound fraction; IP=immunoprecipitated. *Monoclonal antibody; **Recombinant antibody.

For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy.¹⁸ In brief, we plated WT and KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias (Figure 3).

Figure 3. FUS antibody screening by immunofluorescence.

HeLa WT and FUS KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated FUS antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody. Acquisition of the green (identification of WT cells), red (antibody staining) and far-red (identification of KO cells) channels was performed. Representative images of the red (grayscale) channels are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies GTX101810, GTX01039*, 60160-1-Ig*, 11570-1-AP, MA5-32483** and ab124923**, which were titrated as the signals were too weak when following the supplier’s recommendations. Antibody dilution used: NBP2-52874* at 1/1000; GTX101810 at 1/700; GTX01039* at 1/1000; 60160-1-Ig* at 1/2000; 11570-1-AP at 1/1000; MA3-089* at 1/1000; MA5-32483** at 1/1000; ab124923** at 1/1000; ab154141* at 1/1000; ab243880** at 1/500. Bars=10 μm. *Monoclonal antibody; **Recombinant antibody.

In conclusion, we have screened FUS commercial antibodies by Western Blot, immunoprecipitation and immunofluorescence and identified several high-quality antibodies under our standardized experimental conditions. The underlying data can be found on Zenodo.¹⁹^,²⁰

Methods

Antibodies

All FUS antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.²¹ Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-rabbit and anti-mouse secondary antibodies are from Thermo Fisher Scientific (cat. number A21429 and A21424).

Table 2. Summary of the FUS antibodies tested.

Company	Catalog number	Lot number	RRID (Antibody Registry)	Clonality	Clone ID	Host	Concentration (μg/μL)	Vendors recommended applications
Bio Techne	NBP2-52874*	MAB-03520	AB_2885157	monoclonal	CL0190	mouse	1.00	Wb, IF
GeneTex	GTX101810	40366	AB_2036972	polyclonal	-	rabbit	0.70	Wb
GeneTex	GTX01039*	822100287	AB_2888934	monoclonal	JJ09-31	rabbit	1.00	Wb, IF
Proteintech	60160-1-Ig*	10017695	AB_10666169	monoclonal	3A10B5	mouse	2.36	Wb, IP, IF
Proteintech	11570-1-AP	00086256	AB_2247082	polyclonal	-	rabbit	0.90	Wb, IP, IF
Thermo Fisher Scientific	MA3-089*	VB301448	AB_2633334	monoclonal	1FU-1D2	mouse	not provided	Wb, IF
Thermo Fisher Scientific	MA5-32483**	VL3152611	AB_2809760	recombinant-mono	JJ09-31	rabbit	1.00	Wb, IF
Abcam	ab124923**	GR85761-9	AB_10972861	recombinant-mono	EPR5812	rabbit	0.15	Wb, IF
Abcam	ab154141*	GR3368481-1	AB_2885092	monoclonal	CL0190	mouse	1.00	Wb, IF
Abcam	ab243880**	GR3376392-2	AB_2885123	recombinant-mono	BLR023E	rabbit	not provided	Wb, IP, IF

* Monoclonal antibody.

** Recombinant antibody.

CRISPR/Cas9 genome editing

The HeLa FUS KO clone was generated with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA-Rxi-96Rv. Two guide RNAs were used to introduce a STOP codon in the FUS gene (sequence guide 1: AGGGAGUCACAAAAGCCACC, sequence guide 2: GGUACGGUGGUGUUGAUGUC).

Cell culture

Both HeLa WT and FUS KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.²² Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/mL streptomycin (Wisent cat. number 450201).

Antibody screening by Western Blot

Western Blots were performed as described in our standard operating procedure.²³ HeLa WT and FUS KO were collected in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with 1× protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 × g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western Blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Western Blots were performed with large 5-16% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual Western Blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with the HyBlot CL autoradiography films (Denville, cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure.²⁴ Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 μL of phosphate-buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0,01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μL of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by two washes to remove unbound antibodies.

HeLa WT were collected in HEPES buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. One mL aliquots at 1.0 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of HEPES lysis buffer and processed for SDS-PAGE and Western Blot on a 5-16% polyacrylamide gels.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.¹²^–¹⁵^,¹⁸ HeLa WT and FUS KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37^oC, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10ml) in PBS for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary FUS antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/mL for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40× oil objective (NA = 1.40). Analysis was done using the Zen navigation software (Zeiss). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1).

Data availability

Underlying data

Zenodo: Antibody Characterization Report for RNA-binding protein FUS, https://doi.org/10.5281/zenodo.5259944.¹⁹

Zenodo: Dataset for the RNA-binding protein FUS antibody screening study, https://doi.org/10.5281/zenodo.7764130.²⁰

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgments

We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and knockout cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources and collaboration. Members of the group can be found below.

NeuroSGC/YCharOS/EDDU collaborative group: Riham Ayoubi, Thomas M. Durcan, Aled M. Edwards, Carl Laflamme, Peter S. McPherson, Chetan Raina, Kathleen Southern and Zhipeng You.

An earlier version of this of this article can be found on Zenodo (doi: https://doi.org/10.5281/zenodo.5259945)

References

1. Yamaguchi A, Takanashi K: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription. Sci. Rep. 2016; 6: 35195. PubMed Abstract | Publisher Full Text | Free Full Text
2. Zinszner H, Sok J, Immanuel D, et al.: TLS (FUS) binds RNA in vivo and engages in nucleo-cytoplasmic shuttling. J. Cell Sci. 1997; 110(Pt 15): 1741–1750. PubMed Abstract | Publisher Full Text
3. Iko Y, Kodama TS, Kasai N, et al.: Domain architectures and characterization of an RNA-binding protein, TLS. J. Biol. Chem. 2004; 279(43): 44834–44840. PubMed Abstract | Publisher Full Text
4. Dormann D, Rodde R, Edbauer D, et al.: ALS-associated fused in sarcoma (FUS) mutations disrupt Transportin-mediated nuclear import. EMBO J. 2010; 29(16): 2841–2857. PubMed Abstract | Publisher Full Text | Free Full Text
5. Dormann D, Madl T, Valori CF, et al.: Arginine methylation next to the PY-NLS modulates Transportin binding and nuclear import of FUS. EMBO J. 2012; 31(22): 4258–4275. PubMed Abstract | Publisher Full Text | Free Full Text
6. Kwiatkowski TJ Jr, Bosco DA, Leclerc AL, et al.: Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science. 2009; 323(5918): 1205–1208. PubMed Abstract | Publisher Full Text
7. Vance C, Rogelj B, Hortobágyi T, et al.: Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science. 2009; 323(5918): 1208–1211. PubMed Abstract | Publisher Full Text | Free Full Text
8. Mackenzie IR, Rademakers R, Neumann M: TDP-43 and FUS in amyotrophic lateral sclerosis and frontotemporal dementia. Lancet Neurol. 2010; 9(10): 995–1007. Publisher Full Text
9. Van Langenhove T, van der Zee J , Sleegers K, et al.: Genetic contribution of FUS to frontotemporal lobar degeneration. Neurology. 2010; 74(5): 366–371. Publisher Full Text
10. Yu Y, Chi B, Xia W, et al.: U1 snRNP is mislocalized in ALS patient fibroblasts bearing NLS mutations in FUS and is required for motor neuron outgrowth in zebrafish. Nucleic Acids Res. 2015; 43(6): 3208–3218. PubMed Abstract | Publisher Full Text | Free Full Text
11. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8
12. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text
13. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 172. Publisher Full Text
14. Worrall D, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for TDP-43 for use in Western Blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved]. F1000Res. 2023; 12: 277. Publisher Full Text
15. Ayoubi R, Fotouhi M, Southern K, et al.: The identification of high-performing antibodies for transmembrane protein 106B (TMEM106B) for use in Western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 308. Publisher Full Text
16. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text
17. Nusinow DP, Szpyt J, Ghandi M, et al.: Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell. 2020; 180(2): 387–402.e16. PubMed Abstract | Publisher Full Text | Free Full Text
18. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.
19. Alshafie W, Fotouhi M, You Z, et al.: Antibody Characterization Report for RNA-binding protein FUS.2021. Publisher Full Text
20. Laflamme C: Dataset for RNA-binding protein FUS antibody screening study. [Data set]. Zenodo. 2023. Publisher Full Text
21. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text
22. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text
23. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.
24. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 06 Apr 2023

Author details Author details

Walaa Alshalfie
Roles: Investigation, Methodology

Maryam Fotouhi
Roles: Investigation

Riham Ayoubi
Roles: Investigation, Methodology, Visualization, Writing – Review & Editing

Zhipeng You
Roles: Investigation

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Peter S. McPherson
Roles: Conceptualization, Funding Acquisition, Resources, Supervision

Carl Laflamme
Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Writing – Review & Editing

Competing interests

For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems -Thermo Fisher Scientific.

Grant information

This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship.

Article Versions (3)

version 3

Revised

Published: 24 Sep 2024, 12:376

https://doi.org/10.12688/f1000research.133220.3

version 2

Revised

Published: 26 Jun 2023, 12:376

https://doi.org/10.12688/f1000research.133220.2

version 1

Published: 06 Apr 2023, 12:376

https://doi.org/10.12688/f1000research.133220.1

© 2023 Alshalfie W et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Alshalfie W, Fotouhi M, Ayoubi R et al. The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence [version 2; peer review: 2 approved]. F1000Research 2023, 12:376 (https://doi.org/10.12688/f1000research.133220.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 2

VERSION 2

PUBLISHED 26 Jun 2023

Revised

Views

Reviewer Report 26 Jun 2023

Ryota Hikiami, Department of Therapeutics for protein misfolding diseases, Shiga University, Hikone, Shiga Prefecture, Japan

Approved

https://doi.org/10.5256/f1000research.151937.r181569

Thank you for considering my comments and suggestions on your manuscript. I am pleased to say that the majority of the concerns I raised have been adequately addressed.

I have only a minor suggestion.

Introduction (P3, L7 ‘familial ALS/FTD’): Let me write again, as my writing does not seem to be coming across well. If literature reference 9 (Van Langenhove et al., 2010¹) includes “familial” ALS/FTD with a ‘family history’, please disregard it. However, if reference 9 pertains to “sporadic” ALS/FTD without a family history, please include references such as "Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia." as literature on “familial” ALS/FTD.

Thank you once again for your diligent cooperation throughout this process. I truly appreciate your responsiveness and your commitment to addressing the comments and suggestions.

References

1. Yan J, Deng HX, Siddique N, Fecto F, et al.: Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia.Neurology. 2010; 75 (9): 807-14 PubMed Abstract | Publisher Full Text

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Molecular biology, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Version 1

VERSION 1

PUBLISHED 06 Apr 2023

Views

Reviewer Report 23 Jun 2023

Ralph H. Kehlenbach, Department of Molecular Biology, Faculty of Medicine, GZMB, Georg-August-Universitat Gottingen, Göttingen, Lower Saxony, Germany

Approved

https://doi.org/10.5256/f1000research.146199.r178227

In their manuscript „The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence”, Alshalfie and coauthors perform a thorough comparison of commercial antibodies against FUS, a protein that has gained a lot of interest in the field of neurodegenerative diseases and also in general molecular cell biology. Since many antibodies do not perform as good as they are advertised, such a comparison is highly welcome. The approach (also using knockout cell lines as control) is solid and the results are clear and very well documented. I only have one suggestion: in Table 2, the authors should include one or several column(s) (next to “vendors recommended application”) with comments reflecting the results of the study (e.g. ab243880 seems to work well in WB, in IP and in IF).

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 15 Jun 2023

Ryota Hikiami, Department of Therapeutics for protein misfolding diseases, Shiga University, Hikone, Shiga Prefecture, Japan

Approved with Reservations

https://doi.org/10.5256/f1000research.146199.r177190

Dear Laflamme C and co-authors,

Thank you for allowing me to review your manuscript titled "The identification of high-performing antibodies for RNA binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence." Your study investigates the utility of commercially available antibodies targeting FUS, one of the causative genes of ALS, through WB, IP, and IF techniques. The experimental findings presented by the authors are expected to be valuable and beneficial for FUS researchers. While the overall methodology and results are sound, I propose minor revisions.

1. Introduction (P3, L6-):
Unlike ALS, FTD with the FUS gene mutation is rare. Does the attached literature include cases of familial FTLD? If not, I recommend adding relevant references or modifying the text accordingly.

2. Figure 3 (P5):
The mosaic arrangement of WT and KO cells in the image is clear and visually appealing. However, the image coverage appears to be somewhat limited. I suggest expanding the image coverage or adding additional images to enhance the readers' understanding.

I hope these suggestions are helpful in improving the quality and impact of your manuscript. Thank you again for considering my feedback, and I look forward to seeing the revised version.

Best regards,
Ryota Hikiami

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Molecular biology, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Author Response 26 Jun 2023

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

26 Jun 2023

Author Response

Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene ... Continue reading Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene in many neurodegenerative diseases.

To answer your first point of feedback, literature reference 9, which refers to the publication by Van Langenhove et al., performs a mutational analysis of FUS in patients with cases of FTLD. To further elucidate this fact, we will be submitting a revised version with modified text to include FTLD in the list of neurodegenerative diseases potentially caused by FUS gene variants.

As for the second point, we always include a dataset in our reports, which includes all underlying raw data for the experiments performed (reference 20). This increases the transparency and reproducibility of our work. It also allows viewers to have a better understanding of the results and see what wasn’t included in the figures. As for immunofluorescence, the dataset includes czi files of each antibody under the microscope. We hope this provides the additional image coverage you were looking for.

Thank you again for your suggestions!
Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene in many neurodegenerative diseases.

To answer your first point of feedback, literature reference 9, which refers to the publication by Van Langenhove et al., performs a mutational analysis of FUS in patients with cases of FTLD. To further elucidate this fact, we will be submitting a revised version with modified text to include FTLD in the list of neurodegenerative diseases potentially caused by FUS gene variants.

As for the second point, we always include a dataset in our reports, which includes all underlying raw data for the experiments performed (reference 20). This increases the transparency and reproducibility of our work. It also allows viewers to have a better understanding of the results and see what wasn’t included in the figures. As for immunofluorescence, the dataset includes czi files of each antibody under the microscope. We hope this provides the additional image coverage you were looking for.

Thank you again for your suggestions!
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 26 Jun 2023

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

26 Jun 2023

Author Response

Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene ... Continue reading Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene in many neurodegenerative diseases.

To answer your first point of feedback, literature reference 9, which refers to the publication by Van Langenhove et al., performs a mutational analysis of FUS in patients with cases of FTLD. To further elucidate this fact, we will be submitting a revised version with modified text to include FTLD in the list of neurodegenerative diseases potentially caused by FUS gene variants.

As for the second point, we always include a dataset in our reports, which includes all underlying raw data for the experiments performed (reference 20). This increases the transparency and reproducibility of our work. It also allows viewers to have a better understanding of the results and see what wasn’t included in the figures. As for immunofluorescence, the dataset includes czi files of each antibody under the microscope. We hope this provides the additional image coverage you were looking for.

Thank you again for your suggestions!
Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene in many neurodegenerative diseases.

To answer your first point of feedback, literature reference 9, which refers to the publication by Van Langenhove et al., performs a mutational analysis of FUS in patients with cases of FTLD. To further elucidate this fact, we will be submitting a revised version with modified text to include FTLD in the list of neurodegenerative diseases potentially caused by FUS gene variants.

As for the second point, we always include a dataset in our reports, which includes all underlying raw data for the experiments performed (reference 20). This increases the transparency and reproducibility of our work. It also allows viewers to have a better understanding of the results and see what wasn’t included in the figures. As for immunofluorescence, the dataset includes czi files of each antibody under the microscope. We hope this provides the additional image coverage you were looking for.

Thank you again for your suggestions!
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 06 Apr 2023

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 3 (revision) 24 Sep 24		read
Version 2 (revision) 26 Jun 23	read
Version 1 06 Apr 23	read	read

Ryota Hikiami, Shiga University, Hikone, Japan
Ralph H. Kehlenbach, Georg-August-Universitat Gottingen, Göttingen, Germany

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

5 Views

25 Sep 2024 | for Version 3

Ralph H. Kehlenbach, Department of Molecular Biology, Faculty of Medicine, GZMB, Georg-August-Universitat Gottingen, Göttingen, Lower Saxony, Germany

5 Views Cite this report Responses(0)

Approved

approved!

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

10 Views

26 Jun 2023 | for Version 2

Ryota Hikiami, Department of Therapeutics for protein misfolding diseases, Shiga University, Hikone, Shiga Prefecture, Japan

10 Views Cite this report Responses(0)

Approved

Introduction (P3, L7 ‘familial ALS/FTD’): Let me write again, as my writing does not seem to be coming across well. If literature reference 9 (Van Langenhove et al., 2010¹) includes “familial” ALS/FTD with a ‘family history’, please disregard it. However, if reference 9 pertains to “sporadic” ALS/FTD without a family history, please include references such as "Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia." as literature on “familial” ALS/FTD.

Thank you once again for your diligent cooperation throughout this process. I truly appreciate your responsiveness and your commitment to addressing the comments and suggestions.

References

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Molecular biology, neuroscience

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

7 Views

23 Jun 2023 | for Version 1

Ralph H. Kehlenbach, Department of Molecular Biology, Faculty of Medicine, GZMB, Georg-August-Universitat Gottingen, Göttingen, Lower Saxony, Germany

7 Views Cite this report Responses(0)

Approved

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

16 Views

15 Jun 2023 | for Version 1

Ryota Hikiami, Department of Therapeutics for protein misfolding diseases, Shiga University, Hikone, Shiga Prefecture, Japan

16 Views Cite this report Responses(1)

Approved With Reservations

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Molecular biology, neuroscience

Respond to this report

Responses (1)

Author Response

26 Jun 2023

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

Dear Ryota Hikiami,

Thank you for your thorough review of this Data Note which analyses the performance of commercial antibodies for RNA binding protein FUS, a potential causative gene in many neurodegenerative diseases.

To answer your first point of feedback, literature reference 9, which refers to the publication by Van Langenhove et al., performs a mutational analysis of FUS in patients with cases of FTLD. To further elucidate this fact, we will be submitting a revised version with modified text to include FTLD in the list of neurodegenerative diseases potentially caused by FUS gene variants.

As for the second point, we always include a dataset in our reports, which includes all underlying raw data for the experiments performed (reference 20). This increases the transparency and reproducibility of our work. It also allows viewers to have a better understanding of the results and see what wasn’t included in the figures. As for immunofluorescence, the dataset includes czi files of each antibody under the microscope. We hope this provides the additional image coverage you were looking for.

Thank you again for your suggestions!

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Yamaguchi A, Takanashi K: FUS interacts with nuclear matrix-associated protein SAFB1 as well as Matrin3 to regulate splicing and ligand-mediated transcription. Sci. Rep. 2016; 6: 35195. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Zinszner H, Sok J, Immanuel D, et al.: TLS (FUS) binds RNA in vivo and engages in nucleo-cytoplasmic shuttling. J. Cell Sci. 1997; 110(Pt 15): 1741–1750. PubMed Abstract | Publisher Full Text

[3] 3. Iko Y, Kodama TS, Kasai N, et al.: Domain architectures and characterization of an RNA-binding protein, TLS. J. Biol. Chem. 2004; 279(43): 44834–44840. PubMed Abstract | Publisher Full Text

[4] 4. Dormann D, Rodde R, Edbauer D, et al.: ALS-associated fused in sarcoma (FUS) mutations disrupt Transportin-mediated nuclear import. EMBO J. 2010; 29(16): 2841–2857. PubMed Abstract | Publisher Full Text | Free Full Text

[5] 5. Dormann D, Madl T, Valori CF, et al.: Arginine methylation next to the PY-NLS modulates Transportin binding and nuclear import of FUS. EMBO J. 2012; 31(22): 4258–4275. PubMed Abstract | Publisher Full Text | Free Full Text

[6] 6. Kwiatkowski TJ Jr, Bosco DA, Leclerc AL, et al.: Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science. 2009; 323(5918): 1205–1208. PubMed Abstract | Publisher Full Text

[7] 7. Vance C, Rogelj B, Hortobágyi T, et al.: Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science. 2009; 323(5918): 1208–1211. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Mackenzie IR, Rademakers R, Neumann M: TDP-43 and FUS in amyotrophic lateral sclerosis and frontotemporal dementia. Lancet Neurol. 2010; 9(10): 995–1007. Publisher Full Text

[9] 9. Van Langenhove T, van der Zee J , Sleegers K, et al.: Genetic contribution of FUS to frontotemporal lobar degeneration. Neurology. 2010; 74(5): 366–371. Publisher Full Text

[10] 10. Yu Y, Chi B, Xia W, et al.: U1 snRNP is mislocalized in ALS patient fibroblasts bearing NLS mutations in FUS and is required for motor neuron outgrowth in zebrafish. Nucleic Acids Res. 2015; 43(6): 3208–3218. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8

[12] 12. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text

[13] 13. Alshafie W, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 172. Publisher Full Text

[14] 14. Worrall D, Ayoubi R, Fotouhi M, et al.: The identification of high-performing antibodies for TDP-43 for use in Western Blot, immunoprecipitation and immunofluorescence [version 1; peer review: 1 approved]. F1000Res. 2023; 12: 277. Publisher Full Text

[15] 15. Ayoubi R, Fotouhi M, Southern K, et al.: The identification of high-performing antibodies for transmembrane protein 106B (TMEM106B) for use in Western blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 12: 308. Publisher Full Text

[16] 16. Wang M, Herrmann CJ, Simonovic M, et al.: Version 4.0 of PaxDb: Protein abundance data, integrated across model organisms, tissues, and cell-lines. Proteomics. 2015; 15(18): 3163–3168. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Nusinow DP, Szpyt J, Ghandi M, et al.: Quantitative Proteomics of the Cancer Cell Line Encyclopedia. Cell. 2020; 180(2): 387–402.e16. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Alshafie W, McPherson P, Laflamme C: Antibody screening by Immunofluorescence.2021.

[19] 19. Alshafie W, Fotouhi M, You Z, et al.: Antibody Characterization Report for RNA-binding protein FUS.2021. Publisher Full Text

[20] 20. Laflamme C: Dataset for RNA-binding protein FUS antibody screening study. [Data set]. Zenodo. 2023. Publisher Full Text

[21] 21. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text

[22] 22. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text

[23] 23. Ayoubi R, McPherson PS, Laflamme C: Antibody Screening by Immunoblot.2021.

[24] 24. Ayoubi R, Fotouhi M, McPherson P, et al.: Antibody screening by Immunoprecitation.2021.

The identification of high-performing antibodies for RNA-binding protein FUS for use in Western Blot, immunoprecipitation, and immunofluorescence

Abstract

Keywords

Revised Amendments from Version 1

Introduction

Results and discussion

Table 1. Summary of the cell lines used.

Figure 1. FUS antibody screening by Western Blot.

Figure 2. FUS antibody screening by immunoprecipitation.

Figure 3. FUS antibody screening by immunofluorescence.

Methods

Antibodies

Table 2. Summary of the FUS antibodies tested.

CRISPR/Cas9 genome editing

Cell culture

Antibody screening by Western Blot

Antibody screening by immunoprecipitation

Antibody screening by immunofluorescence

Data availability

Underlying data

Acknowledgments

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated