Circadian disruption does not alter tumorigenesis in a mouse model of lymphoma

Mice

Male Eμ-MYC^+/- mice on a C57BL/6 background were purchased from The Jackson Laboratory at eight weeks of age. Eμ-MYC mice express human c-MYC under the control of the immunoglobulin heavy chain (IgH) enhancer resulting in constitutive activation of c-MYC in the B cell lineage.¹⁹ The Eμ-MYC^+/- mice were housed in the Dorris Neuroscience Center vivarium at Scripps Research and bred with the laboratory colony of C57BL/6 females originally purchased from the Scripps Research breeding colony. All mice used in the research described here were heterozygous for the Eμ-MYC transgene (Eμ-MYC^+/-). During breeding for experiments, all mice were included in the study (i.e., no excluded animals). Food and water were provided ad libitum. All efforts were made to ameliorate any suffering of the animals involved in this study: mice showing any signs of advanced disease such as grossly visible tumors, rapid breathing, weight loss, etc., were euthanized by CO₂ inhalation. All animal care and treatments were in accordance with The Scripps Research Institute guidelines for the care and use of animals and were approved by the Institutional Animal Care and Use Committee (IACUC) under protocol number 10-0019.

Chronic jetlag (CJL) conditions

At four weeks of age, mouse littermates were separated and randomly assigned to light-tight boxes set to either the control (continuous cycles of 12 hours of the light followed by 12 hours of dark, LD12:12) or chronic jetlag (eight-hour light phase advances every two to three days, CJL^5,6,9–11) lighting conditions (Figure 1A). For the 12-week tumor burden endpoint study, male and female mice were housed in LD12:12 (n=19) or CJL (n=20) for eight weeks before euthanasia at zeitgeber time (ZT, hours after lights on) ZT9 on the day following the first synchronized 24-hour period (i.e., day two of week nine). To minimize potential confounders, dissections of the LD12:12 and CJL were alternated. For the survival study, male and female Eμ-MYC littermates were housed in LD12:12 (n=23) or CJL (n=23) and monitored weekly for signs of advanced disease. For all analyses, the experimental unit is a single animal. Animals found deceased were not assessed for total tumor weight. Sample size was determined by power analysis guided by the expected variability in outcomes using data from Ref. 21. Experimenters were aware of group allocation.

Figure 1. Eight weeks of chronic jetlag does not impact tumor burden in Eμ-MYC mice.

(A) Schematic depicting the experimental lighting conditions of the Eμ-MYC mice. The white areas represent periods of lights on, and the black areas represent periods of lights off. Control lighting consists of a rotating 12-hour light phase and 12-hour dark phase (LD12:12) and the chronic jetlag lighting includes an eight-hour phase advance every two to three days (CJL). (B) Fraction of mice with tumors observed at the indicated lymph node (LN) in Eμ-MYC females (left, n=21) and males (right, n=18) housed LD12:12 or CJL lighting conditions for eight weeks. (C) Scatter plot with mean of total tumor weight in female and male Eμ-MYC mice after eight weeks in LD12:12 (black) or CJL (red) lighting conditions. There were no significant (ns, p>0.05) differences between groups by two-way ANOVA.

RNA extraction and quantitative real-time PCR

RNA was extracted from liver and spleen tissue that was flash frozen in liquid nitrogen at the time of sacrifice. One mL of Qiazol reagent (Qiagen cat # 799306) was used to isolate RNA from 50 mg of tissue. Tissue homogenization was achieved by bullet blender tissue homogenizer. 200 μl of chloroform was added to homogenized lysates which were transferred into a phase lock tube (VWR cat # 10847-802). Samples were centrifuged for 15 minutes at 13,000 rmp/4 °C. The aqueous phase was transferred to a new tube and 500 μl of isopropanol was used to precipitate RNA. Samples were centrifuged for 15 minutes at 13,000 rpm/4 °C to pellet RNA. Pellet was washed with 1 mL of 75% ethanol, dried, and diluted in 50 μl nuclease free water. Each sample yielded 2–5 μg/μl of RNA quantified by NanoDrop 2000 spectrophotometer (Thermo scientific cat # ND2000). cDNA was prepared using 1 μg of RNA and 4 μl of QScript cDNA Supermix (VWR cat # 101414-106). Thermocyling conditions were 25 °C for 5 minutes, 42 °C for 30 minutes, and 85 °C for 5 minutes and executed using C1000 Touch Thermal Cycler (Bio-Rad cat # 1851148). cDNA was diluted 1:40 with nuclease free water and 4 μl of diluted cDNA, 5 μl of with iQ SYBR Green Supermix (Bio-Rad cat # 1708885), and 0.5 μl of each forward and reverse primers (10 μM) was used per qPCR reaction. cDNA levels were measured by CFX96 Touch Real Time PCR Detection system (Bio-Rad cat # 1845096). Cycling conditions were, step 1: 95 °C for 3 minutes, step 2: 95 °C for 10 seconds, step 3: 55 °C for 10 seconds, step 4: 72 °C for 30 seconds, step 5: go to step 2 39x, step 6: 95°C for 10 seconds, step 7: melt curve 65–95 °C, increments 0.5 °C for 5 seconds + plate read. Amplification was measured and analyzed by Bio-Rad CFX Manager 3.1. Starting quantity (SQ) as determined by the software was used for statistical analysis. Raw data available.²² The following primers were used to detect U36b4 (Forward: AGATGCAGCAGATCCGCA, Reverse: GTTCTTGCCCATCAGCACC), Bmal1 (Forward: TCAAGACGACATAGGACACCT, Reverse: GGACATTGGCTAAAACAACAGTG), P21 (Forward: CCAGGCCAAGATGGTGTCTT, Reverse: TGAGAAAGGATCAGCCAT TGC), E2f1 (Forward: AGGGAAAGGTGTGAAATCTCC, Reverse: TTGGTGATGACATAGATGCGC).

Western blot analysis

Crushed liver and spleen tissues were lysed using RIPA buffer supplemented with protease (Thermo Scientific cat # A32953) and phosphatase (Sigma cat # P5266 and cat # P0044) inhibitors. Protein levels were normalized using the Pierce BCA Protein Assay Kit (Thermofisher cat # PI23225). Lysates were separated in an 8% agarose gel by electrophoresis (Bio-Rad cat # 1658001) and transferred using the Trans-blot Turbo transfer system (Bio-Rad cat # 17001915). Membranes were blocked in 5% milk in Tris-buffered saline supplemented with 1% Tween-20 (TBST) for one hour and washed 3X in TBST for 5 minutes before being placed in primary antibodies overnight at 4 °C. Antibodies were diluted 1:1000 for polyclonal antibody raised in rabbit against BMAL1 (Abcam cat # ab93806), polyclonal antibodies raised in guinea pigs against the C-termini of CRY1 (amino acids 583–606) or CRY2 (amino acids 563–592),²³ monoclonal antibody raised in rabbit against c-MYC (Abcam cat # ab32072); 1:2,000 for monoclonal antibody raised in mouse against REV-ERBα²⁴; 1:50,000 for monoclonal antibody raised in mouse against β-ACTIN (Sigma cat # A1978) in TBST supplemented with 3% bovine serum albumin (BSA). Membranes were washed 3X in TBST for 5 minutes before incubation in secondary antibody (Goat Anti-Mouse IgG (H + L)-HRP Conjugate (Bio-Rad cat # 1706516), Goat Anti-Rabbit IgG (H + L)-HRP Conjugate (Bio-Rad cat # 1706515), Goat Anti-Guinea Pig IgG-HRP Conjugate (Sigma cat # A7289)) diluted 1:5000 in TBST supplemented with 3% BSA for 1 hour at room temperature. Membranes were washed 3X in TBST for 5 minutes before imaging using SuperSignal West Pico PLUS Chemiluminescent Substrate (Fisher scientific cat # PI34095). Imaging and quantification were performed using the ChemiDoc XRS+ System (Bio-Rad cat # 1708265) and Image Lab software version 6.1.0 build 7. Proteins detected by immunoblotting were normalized to the housekeeping protein β-ACTIN. Brightness and contrast of blots were adjusted using PowerPoint version 2022. Any and all adjustments that were made were applied to the entire image. Raw data are available.²²

RNA sequencing and analysis

Total RNA was sent to the BGI Group (formerly Beijing Genomics Institute; Beijing, China) for library preparation and sequencing. Reads (paired-end 150 base pairs at a sequencing depth of 20 million reads per sample) were completed by DNBSEQ Eukaryotic Strand resequencing. FASTQ sequencing files were aligned to the GRCm38 Mus musculus reference genome using SeqMan NGen 17 software (https://www.dnastar.com/manuals/installation-guide). Assemby results were analyzed and counts data were exported using ArrayStar 17 (https://www.dnastar.com/manuals/installation-guide). Differential gene expression analysis (DESeq2) was performed using the online tool Gene Pattern (https://www.genepattern.org) to generated normalized count data and identify differentially expressed genes. The complete RNA-seq data is deposited to [cite Mello figshare dataset as in Ref. 22].

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8 software. The statistics for this research could be reproduced using open-source graphical program for statistical analysis JASP. Significance for total tumor weight from the tumor burden and survival cohorts were determined by two-way ANOVA; qPCR and Western blots were determined by t-test; Kaplan-meier survival curves were determined by Log-rank (Mantel-Cox) test. Significance threshold was set at 0.05 acceptable false positive (p<0.05).

Eight weeks of chronic jetlag does not impact tumor burden in Eμ-MYC mice

Exposure to circadian disruption through altered lighting enhances tumor growth and reduces overall survival in c57BL6/J wildtype mice (due to increased spontaneous development of hepatocellular carcinoma) and in genetically engineered mouse models (GEMMs) of cancer.^5–13 We chose to use a chronic jetlag (CJL) protocol that has been used in several of these studies.^5,6,9–11 Throughout this study, CJL denotes a lighting schedule in which the lights are turned on eight hours earlier (i.e., the light phase is advanced by eight hours) every two to three days (Figure 1A) to mimic circadian disruption experienced by rotating shift workers.

Eμ-MYC mice were housed in either CJL or control (12 hours of light followed by 12 hours of dark, LD12:12) lighting conditions at four weeks of age (Figure 1A). Mice were maintained in CJL or LD12:12 lighting conditions for eight weeks before euthanasia at zeitgeber time (ZT, hours after lights on) ZT9 on the day following the first synchronized 24-hour period (i.e., day 2 of week 9). Four mice (one female from each lighting condition and two males housed in LD12:12) were excluded from the study because they died before the designated endpoint. CJL affected neither the tumor spectrum (Figure 1B) nor overall tumor burden as revealed by the combined weight of all tumors dissected from each animal (Figure 1C) in male or female Eμ-MYC mice. There was no difference in the gross appearance of lymphomas collected from mice housed in LD12:12 or CJL conditions (Supplementary Figure S1). We cannot exclude the possibility that a detailed analysis of lymphoma histolopathology would reveal a subtle difference between groups.

Long-term CJL impacts neither tumor burden nor survival of Eμ-MYC mice

At four weeks of age, female and male Eμ-MYC mice were placed in either LD12:12 or CJL lighting conditions. Mice were housed in these conditions until they exhibited signs of advanced disease (e.g., grossly visible tumors, rapid breathing), at which point mice were euthanized and total tumor weight was recorded. There was no significant difference in the overall survival (Figure 2A) or the terminal tumor weight (Figure 2B) of male or female Eμ-MYC mice exposed to CJL compared to those housed in control LD12:12 lighting conditions.

Figure 2. Long term chronic jetlag does not impact tumor burden or survival of Eμ-MYC mice.

(A) Kaplan-Meier survival curves for female Eμ-MYC mice housed in LD12:12 (solid black, n=11) or in CJL (solid red, n=12) and male Eμ-MYC mice housed in LD12:12 (dashed black, n=12) or in CJL (dashed red, n=11). (B) Scatter plot with mean of total tumor weight at the time of euthanasia of female Eμ-MYC mice housed in LD12:12 (black, n=4) or in CJL (red, n=5) and male Eμ-MYC mice housed in LD12:12 (black, n=5) or in CJL (red, n=8). There were no significant (ns, p>0.05) differences between groups by logrank test (A) or by two-way ANOVA (B).

CJL disrupts circadian rhythms in peripheral tissues

We previously demonstrated that CJL disrupts locomotor activity rhythms in c57BL/6J mice and alters rhythmic gene expression patterns in peripheral tissues of both healthy and tumor-bearing mice.¹¹ To examine the impact of CJL on peripheral clocks in the context of MYC-driven lymphoma, we euthanized Eμ-MYC mice at ZT9, when Bmal1 mRNA is typically low and REV-ERBα protein is typically high in peripheral organs. Livers and spleens were flash frozen at the time of dissection to evaluate molecular circadian rhythms. Consistent with findings in healthy mice,¹¹ Bmal1 mRNA was significantly increased at ZT9 in samples prepared from livers of male and female Eμ-MYC mice that had been exposed to CJL compared to littermates housed in control LD12:12 lighting conditions (Figure 3A). Conversely, NR1D1 protein tended to be lower in liver tissue collected at ZT9 from mice housed in CJL compared to the control group (Figure 3B,C).

Figure 3. Chronic jetlag alters the clock in the peripheral tissues of Eμ-MYC mice.

(A–F) Detection of the indicated transcripts by qPCR (A,E) or unbiased sequencing of total RNA (D) and proteins by immunoblotting (B,C,F,G) in liver (A–D) or spleen (E–G) collected at ZT9 from Eμ-MYC mice housed in LD12:12 or CJL lighting conditions for eight weeks. Data in (A,E) represent the ratio of the indicated transcripts for each sample measured in triplicate. Data in (D) represent normalized counts for the indicated transcripts measured by sequencing total RNA isolated from Eμ-MYC mice housed in LD12:12 (n = 12) or CJL (n = 14). In (B,C,E,F), each lane represents an individual animal. *p<0.05, **p<0.01, ***p<0.001, or not significant (ns, p>0.05) by t-test for (A-C, E-G). In (D) adjusted p values (padj) were calculated in DESeq2. *padj < 0.1, **padj < 0.05, ****padj < 0.0001.

To further probe the impact of CJL on gene expression in the livers of Eμ-MYC mice, we sequenced total RNA prepared from livers collected at ZT9 from male and female Eμ-MYC mice housed in LD12:12 or CJL. Consistent with measurements of gene expression in healthy c57BL6/J mice under the same conditions, exposure to CJL results in elevated expression of genes that are normally low at ZT9 (Arntl, Npas2, Clock) and reduced expression of transcripts that normally peak during the late light phase (Nr1d1, Nr1d2, Per1, Per2, Per3) (Figure 3D). Further, gene expression in samples from mice exposed to CJL is more variable than for those from mice housed in standard LD12:12 conditions. Notably, the amplitude of Cry1 and Cry2 rhythmic expression is generally less than that of other core clock genes and Cry1 and Cry2 transcripts are not significantly impacted by CJL in these samples.

In Eμ-MYC mice, human c-MYC is expressed at a high level in B cells via transgenic expression under the control of the IgH enhancer resulting in generation of MYC-driven lymphomas.¹⁹ The spleen is the site of B cell maturation and we have previously shown that deletion of the clock component Cry2 leads to enhanced expression of MYC in the spleen of Eμ-MYC mice.²¹ Thus, we assessed the impact of circadian disruption in the spleen tissues of the Eμ-MYC mice. There was no significant difference in Bmal1 transcript levels in the spleen tissue from mice exposed to CJL compared to those housed in control lighting conditions (Figure 3E), in contrast to the significant elevation of Bmal1 transcript in liver of the same animals (Figure 3A). NR1D1 protein was significantly lower in spleens collected from male mice that had been exposed to CJL (Figure 3F, G), consistent with the reduced NR1D1 protein detected in livers.

CJL does not alter c-MYC in liver or spleen

We assessed the impact of CJL on c-MYC protein levels and expression of c-MYC transcriptional targets, P21 and E2f1, in liver and spleen of Eμ-MYC mice. c-MYC protein levels were highly variable and were not significantly different in liver tissues of mice housed in CJL compared to those housed in LD12:12 (Figure 4A). There was a significant increase in expression of P21 in liver tissue from mice housed in CJL relative to those housed in LD12:12 (Figure 4B). This is consistent with previous reports of circadian regulation of P21 in murine hepatocytes.²⁵ There was no difference in E2f1 expression in livers collected from mice housed in control or CJL conditions (Figure 4C). Similarly, neither c-MYC protein (Figure 4D) nor expression of the MYC target genes P21 (Figure 4E) and E2f1 (Figure 4F) was affected by CJL in the spleen tissue of male Eμ-MYC mice.

Figure 4. Chronic jetlag has negligible impact on c-MYC in peripheral tissues of Eμ-MYC mice.

(A–F) Detection of the indicated proteins by immunoblotting (A, D) and transcripts by qPCR (B,C,E,F) in liver (A–C) or spleen (D–F) tissues collected at ZT9 from male Eμ-MYC mice housed in LD12:12 or CJL lighting conditions for eight weeks. Each lane in immunoblot represents an individual animal. n = 9 per group. Error bars indicate standard deviation. *p<0.05 or not significant (ns, p>0.05) by t-test.