Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal

Introduction

The genus Trichoderma comprises a highly diverse group of soil dwelling fungi, demonstrating remarkable versatility. These fungi are known for their rapid growth and adaptability, colonizing various habitats from forest soils to agricultural fields. Within this genus, a wide array of strains exhibits significant potential for various applications, including biological control as biopesticides, biofertilizers, soil enhancers and promoters of crop growth.^1,2 Furthermore, Trichoderma isolates have the capacity to stimulate plant defense mechanisms, a phenomenon extensively documented in studies conducted by various researchers.^3–6

The Trichoderma genus was originally proposed by Persoon in Germany in 1794, more than two centuries ago, and their potential as bioagents was first documented by Weindling in 1932.⁷ To date, over 250 Trichoderma species have been identified in soil environments worldwide.⁸ Trichoderma species can be readily isolated from soil using various conventional methods, thanks to their adaptability to diverse conditions, ranging from deserts and wetlands to the Himalayan regions. However, the most effective method for isolating Trichoderma spp. is from rhizospheric soil samples.⁹ A comprehensive understanding of Trichoderma biodiversity is crucial for harnessing the full potential of this genus in various biological applications. Previous surveys that investigated Trichoderma diversity in specific geographical regions have primarily focused on isolates obtained from soil samples. These surveys have been conducted in various locations, including Russia and the Siberian Himalayas,^10,11 Cerrado,¹² China,^13,14 South-East Asia,¹⁵ India,¹⁶ Egypt,¹⁷ Iran,¹⁸ Philippines,¹⁹ Europe,²⁰ Canary Islands,²¹ Sardinia,²² South America,²³ and Turkey.²⁴ The potential of Trichoderma species as biological control agents (BCAs) has been under investigation for over 70 years, and more recently, these species have become commercially available.^25,26 Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions.^27–31 Trichoderma deploys diverse mechanisms, including antibiosis, competition for nutrients and space, mycoparasitism, production of antimicrobial compounds, induction of plant defense responses and enzymatic hydrolysis, to manifest its biocontrol activity.³² These capabilities not only help in managing diseases but also promote plant growth and resilience.

Nepal’s agriculture is dominated by smallholder farmers with limited access to modern agricultural inputs such as chemical pesticides and fertilizers. The country’s diverse agro-ecological zones present both opportunities and challenges for crop production. Trichoderma, with its versatile role in crop production, offers eco-friendly and cost-effective solutions to challenges like biotic stresses (diseases and pests) and abiotic stresses (drought and cold). Additionally, it addresses issues of low soil fertility, particularly in hilly regions, by strengthening plant root systems to improve nutrient and soil absorption. Therefore, identifying native Trichoderma isolates that are better adapted to the local environment, thrive better in local soil conditions, and exhibit versatile capabilities in suppressing multiple stresses in crops is critically important for the successful commercial application of Trichoderma in Nepal. The native isolates of Trichoderma can effectively suppress soil-borne pathogens and improve plant health. Despite the recognized benefits, the commercialization and widespread adoption of Trichoderma-based products in Nepal remain limited. While specific data on the quantity of commercial Trichoderma products and their usage in Nepal are scarce, efforts are underway to explore and promote their application. For instance, initiatives like the “Initial Scoping for Commercial Marketing of Trichoderma and other Biological Solutions in Nepal” aim to assess and enhance the market potential of these biocontrol agents. However, it is important to note that not all Trichoderma species yield the same effects on crops or pathogens. Given the variability in efficacy among different Trichoderma species and strains, it is crucial to identify and characterize native isolates that are well-adapted to local conditions for their effective application as BCAs and the preservation of isolates as viable commercial products.²⁶ Such tailored approaches can maximize the benefits of Trichoderma applications, offering eco-friendly and cost-effective solutions to the challenges faced by Nepalese farmers. Traditional methods for identifying Trichoderma species have conventionally relied on morphological characteristics and culture-based approaches. However, owing to the limited and often indistinguishable morphological features shared among Trichoderma species, alongside the increasing recognition of morphologically cryptic species, accurate identification through these methods becomes challenging and can potentially lead to misidentification.^10,33 As a result, molecular techniques such as amplification of important taxonomic markers, and sequencing have emerged as indispensable tools for achieving precise species identification.^33–36 In the present study, the identification of Trichoderma species at the species level was accomplished by focusing on two key genetic markers: the Internal Transcribed Spacer (ITS) region of rDNA and a partial sequence of the translation elongation factor 1-alpha gene (tef-1α) in addition to classical taxonomy.³⁷ Recent researches have evaluated the ecological specialization of diversity. Numerous studies have documented the discovery of new isolates and phylogenetic species across various natural ecosystems.^21,38 While some studies have been conducted in Nepal, they all have focused on different ecological zones.³⁹ In contrast, limited attention has been given to studying Trichoderma in agricultural environments. Importantly, such investigations have practical implications, as they highlight the potential of agricultural soil rhizosphere as a rich source of beneficial strains with biocontrol capabilities. Building upon these findings, we propose that the composition, distribution, and genetic structure of Trichoderma spp. in the rhizosphere of vegetable crops along with ecological domains and altitudinal gradients may exhibit significant differences. Confirming these differences will enhance our understanding of Trichoderma’s biodiversity across distinct biological niches and various altitudinal gradients across the country.

Methods

Isolation and culture of Trichoderma isolates

To isolate Trichoderma, soil samples were collected from different agricultural regions spanning three ecological zones in Nepal: the plain region (80-141 m above sea level), the mid-hill region (1284-1650 m above sea level), and the high mountain region (1800-2500 m above sea level). These regions exhibited variations in altitude and ecological traits, and were recognized for cultivating a range of agricultural crops. The soil samples were collected from vegetable-growing areas within each region, covering eight districts in Nepal, including Sindhupalchok and Solukhumbu districts in the high mountains; Kathmandu, Lalitpur, Bhaktapur and Kavrepalanchok districts in the mid-hills, and Sunsari and Morang in the plains ( Figure 1).

Figure 1. Map showing soil sampling sites for isolation of Trichoderma isolates.

Using a sterile spatula, approximately 200 grams of soil were collected from the rhizospheric zone of crops such as cauliflower, leaf mustard, cabbage, asparagus bean, tomato, cucumber, brinjal, chilly, pumpkin, and okra. These soil samples were carefully placed in clean polythene bags and appropriately labelled. Subsequently, the soil samples were transported to the National Plant Pathology Research Center, Khumaltar, Nepal and stored at 4°C until isolation.

For isolation, 10 grams soil samples were suspended in 90 ml of sterile distilled water and mixed using a rotary shaking machine set at 260 × g for 30 minutes to ensure thorough homogenization.⁴⁰ To facilitate the isolation, 1 mL aliquots of the soil suspensions were diluted from 10⁻¹ to 10⁻⁵ onto Trichoderma Selective Media (TSM) using the spread plate technique as described by Askew and Laing.⁴¹ After inoculation, Trichoderma colonies were sub-cultured onto potato dextrose agar (PDA) plates and incubated at 28±2°C for seven days to allow for growth. Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, and colour. Depending on the diversity of colony characteristics, one to two colonies were selected from each sample for pure culture preparation. Each individual isolate was assigned a unique code and stored in a PDA slant for further study. Isolates were then grown on PDA plates for 3-5 days for sporulation. Different dilutions (10⁻¹ to 10⁻³) of spore suspension for each isolate were spread on 10% water agar plates and incubated at 28±2°C for 24 hours in the dark to prepare monoconidial cultures. A germinating, isolated single spore was picked up using a sterile needle from the water agar plates and placed on PDA plates to prepare monoconidial culture for each isolate. Spore suspensions were prepared as mentioned earlier and preserved in silica gel for long term storage at -80°C in a deep freezer.⁴²

Molecular characterization of Trichoderma isolates

Thirty-three Trichoderma spp. isolates, representing diverse groups based on similarities in morphological traits such as growth patterns and diffusible pigments, were selected from various ecological regions for DNA extraction and molecular characterization ( Figure 2).

Figure 2. Distribution of Trichoderma species/isolates collected across various ecological regions of Nepal.

Approximately, 30-40 mg of mycelium was scraped off from 3–5-day-old colonies cultured on potato dextrose agar (PDA) using sterilized glass slides prior to sporulation for genomic DNA extraction. The obtained mycelia were then ground in liquid nitrogen and DNA extraction was carried out using the Promega Wizard genomic DNA extraction kit (Catalogue No. A1120) following the manufacturer’s instructions (Promega Corporation, Madison, WI).

A fragment of rRNA containing the internal transcribed spacer regions was amplified using the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG).⁴⁴ The translation elongation factor 1-alpha gene (tef-1α) was amplified using the primers EF1-728F (CATCGAGAAGTTCGAGAAGG)⁴⁵ and TEF1R (GCCATCCTTGGGAGATACCAGC).^10,46,47 Each PCR reaction (25 μL) comprised 12.5 μL of GoTaq^® Green Master Mix (Promega), 9.5 μL of nuclease-free water, 1 μL of each forward and reverse primer (10 mM), and 1 μL of gDNA. The PCR reactions were performed using a thermocycler (LifeEco Thermal Cycler (BIOER)) with the following settings: For ITS: 1 cycle of 2 minutes at 95°C followed by 34 cycles of 30 seconds at 95°C, 30 seconds at 57°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 5 minutes. For tef-1α: 1 cycle of 5 minutes at 95°C followed by 35 cycles of 45 seconds at 95°C, 45 seconds at 63°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 10 minutes. Amplified PCR products (3 μL) were subjected to electrophoresis (45 minutes, 100 volts) in a 1.0% agarose gel stained with GelGreen^® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) alongside a 1 kb DNA ladder (Promega) for size estimation of the amplified bands. The PCR products were purified using the Wizard SV gel and PCR cleanup system (Promega) following the manufacturer’s instructions and were subsequently sequenced using both reverse and forward primers by Sanger sequencing (BGI Solutions Co., Ltd. Tai Po, Hong Kong, China).

Results

Morphological characterization of single spores of Trichoderma isolates

A total of 167 Trichoderma isolates were isolated from soil samples collected from rhizospheric regions of various vegetable crops. Among this collection, 33 Trichoderma isolates were selected based on morphological and microscopic characteristics. The isolates were visually characterized based on phenotypic traits such as colony color (ranging from dark green to cottony whitish green, Plate 1),⁵⁸ growth pattern, presence or absence of aerial mycelium ( Figure 3a, b), as well as the shape and size of phialides ( Figure 3c–f) and conidia ( Figure 3g–i). Additionally, the presence ( Figure 3j) or absence of chlamydospores was observed microscopically ( Table 1).⁵⁹ Isolates from the groups T2, T3, T6, T7, T8, T9, T11, T14, T18, T19, T24 were morphologically and microscopically identified as belonging to the Harzianum clade. Meanwhile, isolates from groups T1, T4, T10, T12, T13, T15, T16, T21, T22, T23, T25 were identified as members of the Viride clade. Isolates from groups T5 and T17 were grouped within Longibrachiatum clade, corresponding to T. longibrachiatum species, while isolates from T20 group were classified within Brevicompactum clade, associated with T. brevicompactum species.

Plate 1. Culture of Trichoderma isolates grown in 28±2°c in potato dextrose agar medium.

Figure 3. Morphological characteristics of Trichoderma isolates.

a, b: with and without aerial mycelium. c–f: different types of phialides. g–i: different types of spores. j: presence of chlamydospores in Trichoderma asperellum.

Table 1. Morphological characteristics of Trichoderma isolates isolated from various ecological zones of Nepal.

Name of Trichoderma isolates		Colony			Phialides			Conidia				Species	Molecular clade
		Form and color	Front color	Reverse color	Aerial mycelium	Conidiation	Size (μm)	Shape	Spore width (μm)x	Coconut odor	Chlamydospore
T1	ToT8	Green color concentric rings	Green	Banana yellow	Present	Whorl	5.8-9.5	Round	1.9-3.3	Present	Absent	T. asperellum	Viride
T2	ST49	green in middle and wooly white periphery	Green	Banana yellow	Absent	Whorl	5-8.5	Round	1.6-2.2	absent	Absent	T. lentiforme	Harzianum
T3	BaT5	Green and white ring	Fern green	Banana yellow	Absent	Whorl	5.1-6.6	Oblong	1.2-2.6	Absent	Absent	T. afroharzianum	Harzianum
T4	ToT7	Creamy wooly green colony	green	Cream	Absent	Whorl	5.0-7.0	Round	1.4-2.2	Present	Absent	T. asperelloides	Viride
T5	PT11	Green and white colony	green	White	Present	Whorl	4.9-7.4	Oblong	2-3.3/1.2-1.9	present	Present	T. longibrachiatum	Longibrachiatum
T6	DT7	Granular granny smith apple	Granny smith apple	cream	Absent	Whorl	6.1-8	Round	1.4-2.9	Absent	Present	T. harzianum	Harzianum
T7	NaT2, MT5	Concentric green ring colony	Green	Sunshine	Absent	Whorl	5-6.4	Round	1.9-2.6	Absent	Present	T. afroharzianum, T. azevedoi	Harzianum
T8	MT8	Concentric ring	Sea green	Straw	Absent	Whorl	4.9-7.4	Round	1.2-3.08	absent	Not clear	T. inhamatum	Harzianum
T9	PanT1	Sea green concentric ring	Sea green	Cream	Absent	Whorl	05-Sep	Oblong	2.5-4.1/0.9-1.9	Absent	Rarely Present	T. camerunense	Harzianum
T10	ST43	Fern green concentric ring	Fern green	Canary yellow	Present	Whorl	5-8.1	Oval	2.2-3.2/1.2-2.9	Present	Present	T. asperellum	Viride
T11	ST10, SolT21, MT4, MT30, MT11, BaT9	Fern green concentric ring	Fern green	Dijon pigment	Absent	Whorl	4.9-9.5	Round	0.9-1.9	Present	Rarely Present	T. afroharzianum	Harzianum
T12	DT22	White center and fern green	Fern green	Cream	Absent	Whorl	5.5-7.6	Round	1.02-2.17	Absent	Present	T. koningii	Viride
T13	SaT4	Granular fern green ring	Fern green	Banana yellow	Absent	Whorl	6.6-11.7	Round	1.2-2.9	Absent	Absen	T. atroviride	Viride
T14	SolT24b	Concentric granny smith apple colony	Granny smith apple green	Sand	Absent	Whorl	4.3-7.9	Round	.6-1.7	Absent	Present	T. afroharzianum	Harzianum
T15	PanT2	Granular green and white colony	Fern green	Tangerine	Absent	Whorl	5.8-10.4	Oblong	1.2-3.8/1.2-1.9	absent	Present	T. asperelloides	Viride
T16	MT9	Wooly white colony	Fern green	Pumpkin orange	Present	Whorl aggregate	6.3-8.8	Round	1.02-2.9	Absent	Rarely present	T. asperellum	Viride
T17	ToT11	Granular fern green colony	Fern green	Mustard yellow	Absent	Solitary	5.2-9.9	Oblong	2.3-3.6/0.9-1.9	Absent	Absent	T. longibrachiatum	Longibrachiatum
T18	PT13	Wooly white colony	White	Sunshine	Absent	Whorl	4.8-6.7	Oblong	2.5-3.6/.9-1.9	Present	Present	T. afroharzianum	Harzianum
T19	ST6	Green concentric ring	green	sunshine	Absent	Whorl	5.5-7.9	Round	.9-1.9	Absent	Present	T. afroharzianum	Harzianum
T20	MT15	Sea green ring colony	Sea green	straw	Absent	Whorl	7.7-10.6	Round	1.2-2.2	Absent	Present	T. brevicompactum	Brevicompactum
T21	KT11, ST20	Fern green colony	Fern green	Banana yellow	Absent	Whorl	7-9.6	Round	1.9-4	Absent	Present	T.asperellum	Viride
T22	NaT7	Fern green and white granular colony	Fern green	Canary yellow	Absent	2-3in Whorl	6.2-8.8	Round	1.9-3.3	Absent	Rarely Present	T.asperellum	Viride
T23	KT6, SolT6b	Granular green and white colony	Fern green	Cream base	Absent	2-3 in Whorl	6.8-8.7	Round	1.6-3.3	Present	Present	T. asperellum	Viride
T24	ST3	Wooly green colony	Green	Canary yellow	Absent	Solitary	6.2-7.7	Round	1.3-2	Absent	Present	T. afroharzianum	Harzianum
T25	KT13	Granular green and white colony	Fern green	white	Absent	Solitary/2-3whorl	5.5-8.4	Round	1.2-2.9	Absent	Present	T. asperellum	Viride

Morphological variations were observed among different groups of Trichoderma isolates ( Table 1).⁵⁹ Illustrations of colonies grown in PDA Petri plates are shown in Plate 1.⁵⁸ Various diffusible pigments were observed, displaying different colors, which were compared to the Audrey & Bear Color Chart (https://audreyandbear.com/products/audrey-bear-color-chart). In the Harzianum clade, which includes species such as T. afroharzianum, T. lentiforme, T. camerunense, T. inhamatum and T. azevedoi colonies exhibited 1-2 concentric rings with the production of green-colored conidia. No diffusible pigments were detected in PDA medium, and a coconut odor was also not noticeable. The conidia were oval to oblong and ranged from 0.6-4.1μm. Within the Viride clade, comprising species like T. asperellum, T. asperelloides, T. koningii and T. atroviride colonies on PDA displayed a somewhat granular appearance with green and white regions distributed throughout the plate. No diffusible pigments were detected in the PDA medium, but coconut odor was found in some groups and absent in others ( Table 1).⁵⁹ The conidia were generally round and ranged from 1-4 μm. The T5 and T17 groups of isolates displayed white mycelium with green pustules and produced yellow diffusible pigments, classifying them within the Longibrachiatum clade. Conidia in this group were oblong and ranged from 2-3.9 μm. Isolates from T20 group were challenging to differentiate and were grouped together, with conidia measuring 1.2-2.2μm. Phialides were flask-shaped in both the Harzianum and Viride clades and were present in whorls in almost all species, except in ST3 (T. afroharzianum) and ToT11(T. longibrachiatum), where they were solitary.

The Harzianum clade was found within an altitudinal range of 80-1800 masl, spanning from lowland plains to hilly regions, and was common in both tropical and temperate regions ( Table 2).⁵⁹ Similarly, the Viride clade were also identified in both tropical and temperate regions, with altitudes ranging from between 90-1475 masl, which was generally lower than that of the Harzianum clade. Isolates of the T20 group (T. brevicompactum) were primarily located in lowland plains (at 80 masl), rather than in higher mountain region, whereas T. longibrachiatum was primarily found in mid-hill regions, with altitudes ranging from 1300-1500 masl ( Table 2).⁵⁹ However, morphological characteristics alone proved insufficient for distinguishing between the various Trichoderma isolates. Therefore, molecular identification was required to differentiate among complex and overlapping Trichoderma isolates.

Table 2. Details of selected Trichoderma isolates from different altitudinal regions with their corresponding geographic locations, isolate names and GenBank accession numbers.

Species	Isolate	GPS location	Altitude (masl)	District	Gen bank Accession No.
					ITS	tef-1α
T. afroharzianum	ST3	26.54N 87.12E	80	Sunsari	OR140790	OR567133
T. afroharzianum	ST6	26.7N 87.28E	95	Sunsari	OR140791	OR567134
T. afroharzianum	ST10	26.58N 87.18E	113	Sunsari	OR140792	OR567135
T. afroharzianum	MT4	26.6N 87.32E	82	Morang	OR140793	OR567136
T. afroharzianum	MT11	26.46N 87.34E	100	Morang	OR140794	OR567137
T. afroharzianum	MT30	26.48N 87.27E	80	Morang	OR140795	OR567138
T. afroharzianum	BaT5	27.69N 85.25E	1360	Kathmandu	OR140796	OR567139
T. afroharzianum	BaT9	27.69N85.25E	1312	Kathmandu	-	OR567140
T. afroharzianum	NaT2	27.65N 85.51E	1605	Kavrepalanchok	OR140797	OR567141
T. afroharzianum	PT13	27.59N 85.51E	1510	Kavrepalanchok	-	OR567142
T. afroharzianum	SolT24b	27.44N 86.59E	1800	Solukhumbu	OR140798	OR567143
T. lentiforme	ST49	26.69N 87.09E	80	Sunsari	OR140799	OR567144
T. inhamatum	MT8	26.56N 87.49E	127	Morang	OR140800	OR567145
T. camerunense	PanT1	27.63N 85.55E	975	Kavrepalanchok	OR1407801	OR567146
T. asperellum	ST20	26.65N 87.28E	113	Sunsari	OR1407802	OR567147
T. asperellum	ST43	26.55N 87.12E	92	Sunsari	OR1407803	OR567148
T. asperellum	MT9	26.66N 87.6E	100	Morang	OR1407804	OR567149
T. asperellum	KT13	27.66N 85.29E	1413	Kathmandu	OR1407805	OR567150
T. asperellum	ToT7	27.75N 85.34E	1339	Kathmandu	OR1407806	OR567151
T. asperellum	ToT8	27.77N 85.33E	1339	Kathmandu	OR1407807	OR567152
T. asperelloides	PanT2	27.63N 85.61E	925	Kavrepalanchok	OR1407808	OR567153
T. asperelloides	KT11	27.68N 85.27E	1370	Kathmandu	-	OR567154
T. atroviride	SaT4	27.64N 85.48E	1475	Kavrepalanchok	-	OR567155
T. brevicompactum	MT15	26.49N 87.29E	80	Morang	OR140809	OR567156
T. azevedoi	MT5	26.49N 87.29E	100	Morang	OR140810	OR567157
T. harzianum	DT7	27.68N 85.93E	2500	Sindhupalchok	OR140811	-
T. afroharzianum	SolT21	27.54N 86.57E	2300	Solukhumbu	OR140812	-
T. asperellum	KT6	27.68N 85.27E	1335	Kathmandu	OR140813	-
T. asperellum	NaT7	27.65N85.51E	1624	Kavrepalanchok	OR140814	-
T. asperellum	SolT6b	27.52N 86.58E	2365	Solukhumbu	OR140815	-
T. koningii	DT22	27.68N 85.93E	2500	Sindhupalchok	OR140816	-
T. longibrachiatum	ToT11	27.75N 85.33E	1349	Kathmandu	OR140817	-
T. longibrachiatum	PT11	27.59N 85.51E	1520	Kavrepalanchok	OR140818	OR567158

Molecular characterization and phylogenetic studies of Trichoderma isolates

Trichoderma isolates were further identified using molecular sequencing data of ITS rRNA and tef-1α genes to support our morphological data. Out of 33 strains, PCR and bidirectional sequencing were successfully completed for 29 presumptive isolates by ITS oligonucleotide barcode identification (OR140790-OR140818) and for only of 26 isolates using tef-1α (OR567133-OR567158). The average consensus sequence length for tef-1α was 663 bp, while for the ITS rRNA, it was 646 bp. Nucleotide BLAST analysis and pairwise alignments of the ITS rRNA and tef-1α sequences identified the Trichoderma isolates as belonging to T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum which shared 97-100% identity match with published sequences in the NCBI database.

The phylogenetic tree ( Figure 4) based on ITS rRNA unambiguously identified 11 species among the 29 isolates, based on their clustering with reference taxa. The isolates identified in the analysis included T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum. Although the ITS rRNA tree could not clearly delimit the species resolution of the isolates MT8, ST49, MT5, and PanT1, however there were clear and distinct resolution of other isolates ( Figure 4). The phylogenetic tree ( Figure 5) obtained from the tef-1α region identified 10 species among the 26 isolates, which included T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. longibrachiatum and T. brevicompactum. The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp), produced four distinct, well supported clades with bootstrap values higher than 70%: Harzianum, Viride, Longibrachiatum and Brevicompactum clades ( Figure 6).

Figure 4. Phylogenetic tree of 29 Trichoderma isolates based on ITS rRNA sequences.

Figure 5. Phylogenetic tree of 26 Trichoderma isolates based on tef-1α gene sequences.

Figure 6. Phylogenetic tree of 22 Trichoderma isolates based on tef-1α -ITS gene sequences.

Thus, based on above three phylogenetic trees, four clades were identified: Harzianum, Viride, Brevicompactum and Longibrachiatum clades. Eighty-five isolates belonged to the Harzianum clade, consisting of T. afroharzianum (64 isolates), T. harzianum (3 isolates), T. lentiforme (1 isolate), T. camerunense (11 isolates T. inhamatum (5 isolates), and T. azevedoi (1 isolate). The Viride clade included 67 isolates, comprising species such as T. asperellum (57 isolates), T. asperelloides (6 isolates), T. atroviride (1 isolate), and T. koningii (3 isolates). The Longibrachiatum clade comprised 11 isolates, all belonging to the T. longibrachiatum. The Brevicompactum clade consisted of 4 isolates, all of which were identified as T. brevicompactum ( Table 3).⁵⁹ Among these, T. afroharzianum was the most abundant species in this study, followed by T. asperellum.

Table 3. List of total number of Trichoderma isolates used for morphological characterization.

S. No.	Code group	No. of isolates present in code group	Name of all isolates in code group	Number of representative isolates taken	Isolates name taken for molecular characterization	Species name
1	T1	3	ToT8, NaT6, ST18	1	ToT8	T. asperellum
2	T2	1	ST49	1	ST49	T. lentiforme
3	T3	3	ST7, BaT5, MT39	1	BaT5	T. afroharzianum
4	T4	5	SaT7, ToT7, SolT3, SolT25, ST39a	1	ToT7	T. asperelloides
5	T5	6	ST38, PanT4, PT11, ToT9, PT14, ST8a	1	PT11	T. longibrachiatum
6	T6	3	LaT9, DT7, SolT10	1	DT7	T. harzianum
7	T7	14	NaT2, MT31, SaT6, NaT1, NaT5, ST2 NaT3, MT33, ST49a, SolT12a, ST9, SaT2, MT18, MT5	2	NaT2, MT5	T. afroharzianum, T. azevedoi
8	T8	5	ToT6, SolT26a, ST11, MT8, ToT4	2	MT8	T. inhamatum
9	T9	11	ST40, MT28, MT29, DT19, SolT6a, ST13, PanT1, DolT14, ToT1, ST27, KT2	1	PanT1	T. camerunense
10	T10	7	KT1, ST5, ST46, KT7, ST8b, ST39b, ST43	1	ST43	T. asperellum
11	T11	31	MT2, MT3, BKT4, MT46, BktT8, MT13, SaT1, ToT5, ST24, ST21, BaT9, SaT9, ST25, SolT14a, ST28, MT1, MT4, MT6, PT4, ST22, MT11, MT49, MT30, MT12, ST10, ST23, MT23, SolT21, MT37, MT19, MT48	6	SolT21, ST10, MT30, MT4, BaT9, MT11	T. afroharzianum
12	T12	3	ST1, PT6, DT22	1	DT22	T. koningii
13	T13	1	SaT4	1	SaT4	T. atroviride
14	T14	1	SolT24b	1	SolT24b	T. afroharzianum
15	T15	1	PanT2	1	PanT2	T. asperelloides
16	T16	1	MT9	1	MT9	T. asperellum
17	T17	5	PanT6, ST48, ST38, ST19, ToT11	1	ToT11	T. longibrachiatum
18	T18	7	PT13, DT24, DT31, DT26, SolT22, ST50, ST15	1	PT13	T. afroharzianum
19	T19	6	LaT3, ST12, KT12, ST6, ST4, ST23	1	ST6	T. afroharzianum
20	T20	4	MT10, MT14, MT17, MT15	1	MT15	T. brevicompactum
21	T21	27	BaT6, BaT12, ST26, LaT11, DT10, BaT3, MT44, PanT5, DT20, DT11, LaT4, PT5, NaT9, DT39, SolT7, MT24, SolT26b, DolT3, SaT3, ST20, SolT15, DolT23, BktT1, KT11, PanT9, SolT12b, DolT2	3	ST20, KT11	T. asperellum
22	T22	6	ST47, KT4, NaT7, SolT18, ST35, PanT8	1	NaT7	T. asperellum
23	T23	12	MT21, KT6, SolT6b, BktT5, BktT11, ST34, BktT3, DolT18, SolT13, SolT12c, BaT11, LaT12	2	KT6, SolT6b	T. asperellum
24	T24	3	BaT1, ST3, MT41	1	ST3	T. afroharzianum
25	T25	1	KT13	1	KT13	T. asperellum
Total	N = 25	N = 167		N = 33

Analysis of the diversity among Trichoderma species

Table 4 shows Simpson’s biodiversity index (D), Shannon’s biodiversity index (H), evenness (J), and the abundance index (E) for various agricultural fields in different ecological zones. The highest species diversity and evennesswere recorded in the high mountain region, with Shannon’s index (H) of 1.724, evenness (J) of 0.84 and Simpson’s index (D) of 0.28). Following this the hilly region which exhibited the Shannon’s index of 1.563, eveness of 0.7 and Simpson’s index of 0.28. In contrast, the plain region had the lowest species diversity with Shannon’s and Simpson’s diversity indices and evenness estimated to be H = 1.515, J=0.66, D = 0.33. The species abundance values were E = 2.11 for the plain, E = 1.95 for mid-hill and E = 1.99 for the high mountain region. The dominance values (Y) of T. afroharzianum T. asperellum, T. camerunense and T. longibrachiatum were 0.04, 0.03, 0.01, and 0.01 respectively and they were classified as the principal species. On average, the diversity values for Trichoderma species were H = 1.61, D = 0.29, J = 0.74, and E= 2.02 ( Table 4). Simpson’s index (1-D) and the evenness index were close to 1 in all regions except for the plain region, indicating a very high diversity of Trichoderma species in the major agricultural areas of Nepal. The number of species and isolates, as well as the dominant species of Trichoderma, varied geographically ( Table 5) revealing that the mid hill and high mountain regions have a high diversity of Trichoderma species.

Table 4. Univariate diversity indices of Trichoderma isolates from different altitudinal region of Nepal.

Ecological indices	Ecological regions
	Plain	Mid-hill	High mountain	Average
Simpson’s index (D)	0.33 (1-D = 0.67)	0.28 (1-D = 0.72)	0.28 (1-D = 0.72)	0.29
Shannon’s index (H)	1.515	1.563	1.724	1.61
Pielou's evenness (J)	0.66	0.72	0.84	0.74
Abundance index (E)	2.11	1.95	1.99	2.02

Table 5. Details of Trichoderma isolates from different altitudinal regions.

Trichoderma Species	Number of Trichoderma isolates
	Plain	Mid-hill	High altitude	Total
Trichoderma arfoharzianum	38	18	8	64
Trichoderma asperellum	15	26	16	57
Trichoderma camerunense	5	3	3	11
Trichoderma longibrachiatum	4	6	1	11
Trichoderma asperelloides	1	3	2	6
Trichoderma inhamatum	2	2	1	5
Trichoderma brevicompactum	4	0	0	4
Trichoderma harzianum	0	1	2	3
Trichoderma koningii	1	1	1	3
Trichoderma lentiforme	1	0	0	1
Trichoderma azevedoi	1	0	0	1
Trichoderma atroviride	0	1	0	1
Total	72	61	34	167

Discussion

The remarkable biodiversity found in Nepal can be attributed directly to its unique geographical position, which spans a broad spectrum of altitudinal variances and a wide array of climatic conditions. Consequently, Nepal holds a significant position as one of the world’s important biodiversity hotspots. The fungal genus Trichoderma has been extensively studied for its diverse metabolites and their applications in agriculture, industry and health.⁶ Its ability to establish beneficial interactions with plants and produce bioactive compounds makes it a valuable resource for sustainable and eco-friendly solutions in multiple sectors.²⁸ However, there have been very few studies on the diversity of Trichoderma species in Nepal compared to other parts of the world.^10,14,39

In the present study, the isolates of Trichoderma (n = 167) isolated from soils of different ecological zones were categorized into three clades based on their morphological characterization: Harzianum, Viride and Longibrachiatum. However, some isolates were challenging to differentiate and were not assigned to any specific clade (T20). Our observations in terms of morphological characterization align with the previous studies on these species.^42,60 The use of a single method for identifying Trichoderma species can present challenges and potential issues. To address this concern, Bissett proposed integration of both morphological and molecular studies.⁶¹ This combined approach allows for a more comprehensive and accurate species-level classification within Trichoderma spp. In our study, species were identified following previous studies that utilized ITS and tef-1α sequencing.⁶² Using molecular approaches, we were able to clearly identify some cryptic species, and we also distinguished isolates that could not be identified solely based on morphological features.

Trichoderma species are typically identified through gene sequence analysis, with the generally accepted practice being the use of two gene sequences. However, recent studies suggest that the identification of new Trichoderma species may require the analysis of at least three DNA gene sequences.^63,64 In this particular study, 33 Trichoderma isolates were selected from a pool of 167 isolates isolated from soil samples that were collected from various regions of Nepal. To identify these isolates, we analyzed two DNA gene sequences: the ITS rRNA and the tef-1α genes. This analysis involved comparing the obtained sequences with those available in the NCBI database using BLASTn analysis. It has been observed that relying solely on individual gene sequences, such as ITS rRNA or tef-1α , is insufficient for accurately distinguishing all Trichoderma species.

The phylogenetic analysis using ITS rRNA and tef-1α regions revealed significant insights into the diversity and taxonomy of Trichoderma isolates. The ITS tree identified 11 species among 29 isolates, clustering most with reference taxa; however, it could not resolve species for four isolates (MT8, ST49, MT5, and PanT1), indicating its limitations for closely related species. In contrast, the tef-1α tree identified 10 species among 26 isolates, offering better resolution, particularly for closely related taxa such as T. atroviride and T. asperelloides. The maximum likelihood tree, based on a concatenated dataset (ITS + tef-1α), provided the most robust results, forming four well-supported clades: Harzianum, Viride, Longibrachiatum, and Brevicompactum. This approach demonstrated the enhanced resolution achieved by integrating multiple markers, confirming species boundaries and phylogenetic relationships. These findings emphasize the complementary roles of ITS and tef-1α in species identification and highlight the importance of combined datasets for accurate classification. Future work can expand on these results using whole-genome sequencing to further refine taxonomy and explore functional diversity.

As a result, we used a combination of ITS rRNA and tef-1α gene sequences, for a more comprehensive understanding of Trichoderma species distribution. In BLASTn searches, ITS sequences did not provide sufficient resolution of Trichoderma phylogeny for some species, such as the T. harzianum complex. However, the concatenated dataset (ITS-tef-1α) produced four well-supported clades. The resulting tree grouped together the same or closely related species into distinct clades. The comparison of test and conference taxa aligned with earlier reports.^13,65,66 The findings revealed similarities among Trichoderma species, with the out-group sequence of Fusarium oxysporum forming dissimilar clusters. Although tef-1α sequencing provided a clear picture of Trichoderma phylogeny, the predominant species complex (T. harzianum complex) comprises multiple cryptic species.^67,68 The T. harzianum complex has undergone significant revision in recent times, resulting in the classification of T. harzianum into 14 distinct species.^69,70

In this research, we conducted a comprehensive examination of the diversity of indigenous Trichoderma species found in the rhizospheric soil across different districts of Nepal, taking into account variations in altitude. We assessed Trichoderma species diversity, which is defined as the product of the evenness and the number of species, using the Shannon biodiversity index -H.⁵⁵ To evaluate the dominance of individual species, we calculated Simpson’s diversity index,⁵⁴ which indicates the probability that two randomly selected species from a given ecosystem will belong to different categories. We also used Margalef’s abundance index to assess species richness and the Pielou index to determine the evenness of the Trichoderma population. The diversity and occurrence of Trichoderma species reported from different agroclimatic zones of Nepal, namely, the plain (80-141 masl), mid-hill (1284-1650 masl), and high mountain (1800-2500 masl) regions, clearly indicate that climatic topography and soil type are major factors influencing the distribution of Trichoderma species.

The present study aimed to assess the suitably of several widely used diversity indices for various types of statistical analyses. We conducted both simple and multifaceted statistical analyses to determine if certain indices were better suited for specific types of analyses. Notably, Simpson’s index(1-D) and the evenness index approached 1 in the mid-hill and high mountain regions, except in the plain region. This observation suggests a remarkably high diversity of Trichoderma species in the major agricultural areas of Nepal, particularly in the mid-hill and high mountain regions. This is obvious that mountains and hills have high climatic diversity due to latitudinal variation compared to plain and harbor higher diversity of Trichoderma species compared to plain.

These findings underscore the substantial diversity of Trichoderma species in these specific regions. Interestingly, Shannon’s index yielded quite similar values (~1.5) in the plain and mid-hill regions, which could be attributed to the extensive disturbance caused by human activities in both regions. The results of this study indicate that Trichoderma spp. diversity and habitat preference can serve as natural indicators of rhizosphere soil health. Moreover, our findings align with the research conducted by Ma⁵³ in Chinese grasslands of China and Mulatu⁷¹ in Ethiopian coffee ecosystems. This diversity analysis of Trichoderma strains will facilitate the improved identification of Trichoderma species with biocontrol mechanisms, which can, in turn, contribute to the development of suitable bioformulations in sustainable agriculture.

The number of Trichoderma species and isolates, as well as the dominant species, varied significantly across different geographical regions. The plain region (80-141 masl) encompasses two districts, Sunsari and Morang. In this region, we identified a total of six different species of Trichoderma: T. afroharzianum, T. lentiforme, T. inhamatum, T. asperellum, T. brevicompactum and T. azevedoi. We found a total of 72 isolates in the plain region, with T. afroharzianum (38 isolates) being the dominant species. The mid-hill region (1284-1650 masl) includes four main districts: Kathmandu, Lalitpur, Bhaktapur, and Kavrepalnchok. Here we identified six different types of Trichoderma species: T. afroharzianum, T. camerunense, T . longibrachiatum, T. asperellum, T. asperelloides and T. atroviride with total of 61 isolates. In the mid-hill region, T. asperellum (26 isolates) was the dominant species. The high mountain region (1800-2500 masl) comprises two districts, Solukhumbu and Sindhupalchok. In this region, we found only four Trichoderma species: T. harzianum, T. afroharzianum, T. asperellum and T. koningii, with a total of 34 isolates. In this region, T. asperellum (16 isolates) was the dominant species. The presence of these Trichoderma species in the rhizospheric soils of vegetables in Nepal can be attributed to the diverse ecological substrates and climate conditions in the country’s vegetable crop growing areas. Our results suggest that these areas provide an optimal environment for the survival and colonization of a diverse group of Trichoderma species. Trichoderma afroharzianum (39.0%) was found to be the most widely distributed and abundant species in our study. The occurrence of Trichoderma species is influenced by various factors, including metabolic diversity, reproductive capabilities, substrate availability and the competitive abilities of Trichoderma isolates in natural ecosystems.

In the present, we identified nine new country record of Trichoderma species: T. afroharzianum T. harzianum, T. lentiforme, T. inhamatum, T. camerunense, T. atroviride, T. brevicompactum, T. longibrachiatum and T. azevedoi. However, these species have previously been described in regions across the world, including America,^68,72,73Asia,^10,16,17Africa^9,35,71and European Mediterranean countries.^25,46 During this study, we reisolated some species, including T. asperellum, T. asperelloides and T. koningii, along with nine additional species. However, two previously reported species, T. rugulosum and T. lixii were not found in this study.^10,39 The Harzianum clade contained economically important species such as T. harzianum, T. afroharzianum, T. camerenunse, T. lentiforme and T. inhamatum, which are used in agriculture as biological control agents. The Viride clade included T. asperellum, T. asperelloides, T. koningii and T. atroviride. The Longibrachiatum clade consisted of T. longibrachiatum, while the Brevicompactum clade with T. brevicompactum. T. longibrachiatum has high optimal and maximum growth temperatures and exhibits yellow reverse pigmentation due to the production of secondary metabolites such as pyrone. T. brevicompactum is utilized in the production of various antimicrobial substances, offering significant agricultural, health, and environmental benefits.

In this study, we obtained isolates of T. harzianum, T. afroharzianum, T. inhamatum, T. lentiforme, T. azevedoi, T. camerunense, T. asperellum, T. asperelloides, T. atroviride, T. koningii, T. longibrachiatum, and T. brevicompactum from various crop ecosystems. Notably, T. afroharzianum and T. asperellum were most widely distributed species in our study. However, previous studies in crop ecosystems in Nepal have reported T. asperellum and T. asperelloides as the most widely distributed species of this genus.³⁹ It is worth noting that among these reported species, only T. asperellum, T. asperelloides and T. koningii have been previously documented in Nepal.^10,39

Conclusion

This study presents novel findings regarding the presence of Trichoderma species in the Himalayan foothills of Nepal at different altitudes in previously unexplored geographic regions. However, it is important to note that our observations provide only a limited glimpse into the overall diversity of Trichoderma in Nepal. Despite being recognized as a biodiversity hotspot, fungal diversity in this region remains poorly understood. To gain a more comprehensive understanding, further investigations involving the isolation of Trichoderma from various substrates like forest areas and high-altitude areas in Nepal are highly recommended. Such endeavors are likely to unveil a multitude of additional species, some of which may be previously unknown. These new discovered taxa hold significant potential for various biotechnological applications and can contribute to further advancements in this field.

Author information

Authors and Affiliations

Puja Jaiswal

Central Department of Zoology, Tribhuvan University, Kirtipur, Nepal

Ram B. Khadka and Suraj Baidya

National Plant Pathology Research Center, Nepal Agricultural Research Council, Khumaltar, Nepal

Aashaq Hussain Bhat

Department of Bioscience, University Centre for Research and Development, Chandigarh University, Punjab, India

Arvind Kumar Keshari

Department of Zoology, Patan Multiple Campus, Tribhuvan University, Lalitpur, Nepal

Author’s contributions

Puja Jaiswal conceptualized, did data curation, formal analysis, investigation, methodology, validation and writing original draft. Ram Bahadur Khadka worked on conceptualization, formal analysis, investigation, methodology, project administration, resources, supervision, and validation of the study. Suraj Baidya helped with writing, review and editing the manuscript. Aashaq Hussain Bhat did formal analysis, validation and writing, review and editing the manuscript. Arvind Kumar Keshari conceptualization, project administration, resources, supervision, validation, writing, review and editing the manuscript. All authors read and agree to the final draft of the paper.

Ethics and consent

The present study didn’t involve the use of human and animals so ethical approval and consent were not required.