A guide to selecting high-performing antibodies for S1PR1 (UniProt ID: P21453) for use in western blot, immunoprecipitation, and immunofluorescence

Antibodies and cell line used

Cell lines used and primary antibodies tested in this study are listed in Tables 1 and 2, respectively. To ensure that the cell lines and antibodies are cited properly and can be easily identified, we have included their corresponding Research Resource Identifiers, or RRID.^15,16 SK-HEP-1 KO clone corresponding to the S1PR1 gene was generated with low passage cells at Abcam. Two guide RNAs were used to induce a deletion in the S1PR1 gene (sequence guide 1: TCAACTATGATATCATCGTC, sequence guide 2: GCTGAATATCAGCGCGGACA). Peroxidase-conjugated goat anti-rabbit and anti-mouse are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Protein A:HRP is from MilliporeSigma (cat. number P8651).

Antibody screening by western blot

SK-HEP-1 WT and S1PR1 KO (listed in Table 1) were collected in RIPA buffer (25mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) from Thermo Fisher Scientific (cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly, rocked for 30 min in a cold room, then spun at ~110,000 × g for 15 min at 4°C. Equal aliquots of 30 μg supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels from Thermo Fisher Scientific (cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer from Bio-Rad (cat. number 1610772), loaded in Laemmli loading sample buffer from Thermo Fisher Scientific (cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4°C with 5% milk in TBS with 0.1% Tween 20 (TBST) from Cell Signaling Technology (cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL from Thermo Fisher Scientific (cat. number 32106) or Clarity Western ECL Substrate from Bio-Rad (cat. number 1705061) prior to detection with the iBright™ CL1500 Imaging System from Thermo Fisher Scientific (cat. number A44240).

Antibody screening by immunoprecipitation

Antibody-beads conjugates were prepared by adding 2.0 μg to 500 μl of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a microcentrifuge tube, together with 30 μl of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) from Thermo Fisher Scientific (cat. number 10002D and 10004D, respectively). Tubes were rocked for ~1 hr at 4°C followed by two washes to remove unbound antibodies.

SK-HEP-1 WT were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked for 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. 0.5 ml aliquots at 2.0 mg/ml of lysate (1 mg) were incubated with an antibody-bead conjugate for ~1 hr at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP lysis buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A:HRP (MilliporeSigma, cat. number P8651) was used as a secondary detection system at a concentration of 2.0 μg/ml.

Antibody screening by immunofluorescence

SK-HEP-1 WT and S1PR1 KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated in a 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator. Cells were fixed in 4% PFA (in PBS) for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary S1PR1 antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS.

Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20× NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 × 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification. Figures were assembled with Adobe Illustrator.¹⁷

Limitations

Inherent limitations are associated with the antibody characterization platform employed in this study.¹¹ The authors do not claim to have expertise in S1PR1 or sphingosine-1-phosphate signalling mechanisms, which is why a brief background of the protein’s function and relevance in disease is provided. Adopting an agnostic approach, the authors perform antibody-based applications and share the results openly, leaving the analysis and interpretation up to the readers.

For the YCharOS effort, experiments are not commonly performed in replicates. The rationale behind this approach is related to the fact that the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted. A repeat of the western blot screening experiment, along with the analysis of antibody performance in immunofluorescence across thousands of cells, using the analysis code available on GitHub, is available as extended data on Zenodo.

As comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell line for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations should impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.