A guide to selecting high-performing antibodies for S1PR1 (UniProt ID: P21453) for use in western blot, immunoprecipitation, and immunofluorescence

Riham Ayoubi; Maryam Fotouhi; Charles Alende; Sara González Bolívar; Kathleen Southern; Carl Laflamme; NeuroSGC/YCharOS/EDDU collaborative group; ABIF consortium

doi:10.12688/f1000research.153244.2

Home Browse A guide to selecting high-performing antibodies for S1PR1 (UniProt...

ALL Metrics

Views

Downloads

Get PDF

Get XML

Export

▬

✚

Data Note

Revised

A guide to selecting high-performing antibodies for S1PR1 (UniProt ID: P21453) for use in western blot, immunoprecipitation, and immunofluorescence

[version 2; peer review: 1 approved, 1 approved with reservations]

Riham Ayoubi¹, Maryam Fotouhi¹, Charles Alende¹, [...] Sara González Bolívar¹, Kathleen Southern¹, Carl Laflamme ¹, NeuroSGC/YCharOS/EDDU collaborative group, ABIF consortium

Riham Ayoubi¹, Maryam Fotouhi¹, [...] Charles Alende¹, Sara González Bolívar¹, Kathleen Southern¹, Carl Laflamme ¹, NeuroSGC/YCharOS/EDDU collaborative group, ABIF consortium

PUBLISHED 05 Sep 2024

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada

Riham Ayoubi
Roles: Data Curation, Investigation, Methodology, Validation, Visualization, Writing – Review & Editing

Maryam Fotouhi
Roles: Investigation

Charles Alende
Roles: Investigation, Validation, Visualization

Sara González Bolívar
Roles: Investigation

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Carl Laflamme
Roles: Conceptualization, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the YCharOS (Antibody Characterization through Open Science) gateway.

Abstract

Sphingosine 1-phosphate receptor 1 (S1PR1) is a G-coupled protein receptor that induces crucial biological processes when bound by sphingosine 1-phosphate. Here, we have characterized nine S1PR1 commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs.

Keywords

UniProt ID P21453, S1PR1, sphingosine 1-phosphate receptor 1, EDG1, antibody characterization, antibody validation, western blot, immunoprecipitation, immunofluorescence

Corresponding author: Carl Laflamme

Competing interests: For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABCD antibodies- ABclonal- Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific.

Grant information: This work was supported in part by the Emory-Sage-SGC TaRget Enablement to Accelerate Therapy Development for Alzheimer’s Disease (TREAT-AD) center established by the National Institute on Aging (grant no. U5AG065187). It was also supported by the Government of Canada through Genome Canada, Genome Quebec, and Ontario Genomics (grant no. OGI-210). RA is supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2024 Ayoubi R et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Ayoubi R, Fotouhi M, Alende C et al. A guide to selecting high-performing antibodies for S1PR1 (UniProt ID: P21453) for use in western blot, immunoprecipitation, and immunofluorescence [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2024, 13:792 (https://doi.org/10.12688/f1000research.153244.2) First published: 11 Jul 2024, 13:792 (https://doi.org/10.12688/f1000research.153244.1) Latest published: 24 Jan 2025, 13:792 (https://doi.org/10.12688/f1000research.153244.3)

Revised Amendments from Version 1

To enhance transparency and reproducibility of the antibody characterization procedure, version 2 has been prepared. The Methods section now provides a description of the experimental setup for each application. In the Results and discussion section, the strategy for obtaining and preparing the cell lines used is briefly outlined, and an additional table is displayed to guide viewers in assessing the antibody characterization results. Lastly, a Limitations section is now provided to address the inherent limitations of the platform.

See the authors' detailed response to the review by Melissa Pitman

Introduction

Sphingosine 1-phosphate receptor 1 (S1PR1), is a G-protein coupled receptor that binds to its abundant ligand, sphingosine 1-phosphate, inducing intracellular signalling pathways related to cell growth, differentiation, migration and trafficking.¹^–⁴ Also referred to as endothelial differentiation gene 1, S1PR1 plays a role in regulating endothelial cell behaviour, maintaining vascular integrity and promoting angiogenesis. Additionally, it regulates inflammatory responses by modulating T-cell trafficking.³^,⁵

S1PR1 activation by sphingosine 1-phosphate is essential for neuronal events, and its dysregulation may contribute to the pathogenesis of Alzheimer’s disease.⁶^,⁷ A promising target for treating a variety of human diseases, the availability of high-performing S1PR1 antibodies would facilitate S1PR1 research and help uncover therapeutic strategies.³

This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterizing commercial antibodies for human proteins using standardized protocols, and openly sharing the data.⁸^–¹⁰ Here we evaluated the performance of nine commercial antibodies for S1PR1 for use in western blot, immunoprecipitation, and immunofluorescence, enabling biochemical and cellular assessment of S1PR1 properties and function. The platform for antibody characterization used to carry out this study was endorsed by a committee of industry and academic representatives. It involves identifying appropriate cell lines with adequate target protein expression, developing or contributing equivalent knockout (KO) cell lines and finally, characterizing most commercially available antibodies against the corresponding target protein. The standardized antibody characterization protocols are openly available on Protocol Exchange (DOI: 10.21203/rs.3.pex-2607/v1).¹¹

The authors do not engage in result analysis or offer explicit antibody recommendations. A limitation of this study is the use of universal protocols - any conclusions remain relevant within the confines of the experimental setup and cell line used in this study. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret antibody characterization data found in this study are featured on the YCharOS gateway.¹²

Results and discussion

Our standard protocol involves comparing readouts from WT (wild type) and KO cells.¹³^,¹⁴ The first step is to identify a cell line(s) that expresses sufficient levels of S1PR1 to generate a measurable signal using antibodies. To this end, we examined the DepMap transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log₂ (transcripts per million “TPM” + 1), which we have found to be a suitable cut-off (Cancer Dependency Map Portal, RRID:SCR_017655). The SK-HEP-1 cells expresses the S1PR1 transcript at 6.5 log₂ (TPM+1) RNA levels, which is above the average range of cancer cells analyzed. The parental SK-HEP-1 cell line was obtained from the American Type Culture Collection (ATCC) while S1PR1 KO SK-HEP-1 cells, prepared using CRISPR/Cas9 technology, was custom made from Abcam (Table 1).

Table 1. Summary of the cell lines used.

Institution	Catalog number	RRID (Cellosaurus)	Cell line	Genotype
ATCC	HTB-52	CVCL_0525	SK-HEP-1	WT
Abcam	-	-	SK-HEP-1	S1PR1 KO

For western blot experiments, WT and S1PR1 KO protein lysates were rain on SDS-PAGE, transferred onto nitrocellulose membranes, and then probed with nine S1PR1 antibodies (Table 2) in parallel (Figure 1).

Table 2. Summary of the S1PR1 antibodies tested.

Company	Catalog number	Lot number	RRID (Antibody Registry)	Clonality	Clone ID	Host	Concentration (μg/μl)	Vendors recommended applications
Abcam	ab233386**	GR3404607-2	AB_2928162	recombinant-mono	EPR21202	rabbit	0.43	Wb
ABclonal	A12935	59370101	AB_2759781	polyclonal	-	rabbit	1.10	Wb
Aviva Systems Biology	ARP80838	QC56393-190325	AB_3083071	polyclonal	-	rabbit	0.50	Wb
Novus Biologicals (a Bio-Techne brand)	NBP2-67129**	HN1019	AB_3083072	recombinant-mono	JM10-66	rabbit	1.00	Wb, IF
Cell Signaling Technology	63335**	1	AB_3083073	recombinant-mono	E8U3O	rabbit	0.20	Wb, IP, IF
Proteintech	55133-1-AP	89828	AB_10793721	polyclonal	-	rabbit	1.00	Wb, IP
Thermo Fisher Scientific	MA5-32587**	XC3523726	AB_2809864	recombinant-mono	JM10-66	rabbit	1.00	Wb, IF
Thermo Fisher Scientific	MA5-35431**	XC3523881	AB_2849332	recombinant-mono	ARC0881	rabbit	0.29	Wb
Thermo Fisher Scientific	MA5-38484*	XC3523353	AB_2898397	monoclonal	8EAH5	mouse	1.00	Wb

* Monoclonal antibody.

** Recombinant antibody.

Figure 1. S1PR1 antibody screening by western blot.

Lysates of SK-HEP-1 (WT and S1PR1 KO) were prepared and 30 μg of protein were processed for western blot with the indicated S1PR1 antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from precast midi 4-20% Tris-Glycine polyacrylamide gel (Thermo Fisher Scientific, cat number WXP42012BOX) to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Antibody dilution used: ab233386** at 1/1000, A12935 at 1/1000, ARP80838 at 1/500., NBP2-67129** at 1/1000, 63335** at 1/1000, 55133-1-AP at 1/1000, MA5-32587** at 1/1000, MA5-35431** at 1/1000, MA5-38484* at 1/500. Predicted band size: 42.8 kDa. *Monoclonal antibody, **Recombinant antibody.

We then assessed the capability of all nine antibodies to capture S1PR1 from SK-HEP-1 protein extracts using immunoprecipitation techniques, followed by western blot analysis. For the immunoblot step, a specific S1PR1 antibody identified previously (Figure 1) was selected. Equal amounts of the starting material (SM), the unbound fraction (UB), as well as the whole immunoprecipitate (IP) eluates were separated by SDS-PAGE (Figure 2).

Figure 2. S1PR1 antibody screening by immunoprecipitation.

SK-HEP-1 lysates were prepared, and immunoprecipitation was performed using 2.0 μg of the indicated S1PR1 antibodies pre-coupled to Dynabeads protein A or protein G. Samples were washed and processed for western blot on a precast midi 4-20% Tris-Glycine polyacrylamide gel with the indicated S1PR1 antibodies. For western blot, ab233386** was used at 1/1000. The Ponceau stained transfers of each blot are shown. SM = 4% starting material; UB = 4% unbound fraction; IP = immunoprecipitate, HC = antibody heavy chain, LC = antibody light chain. *Monoclonal antibody, **Recombinant antibody.

For immunofluorescence, nine antibodies were screened using a mosaic strategy. This strategy takes advantage of the WT and KO cells being plated together as a mosaic, to enable imaging within a single field of view. To create this mosaic, the SK-HEP-1 WT and S1PR1 KO cells were first labelled with different fluorescent dyes in order to distinguish the two cell lines, and the S1PR1 antibodies were evaluated. Both WT and KO cells were imaged in the same field of view to reduce staining, imaging and image analysis bias (Figure 3). Quantification of immunofluorescence intensity in hundreds of WT and KO cells was performed for each antibody tested,¹¹ and the images presented in Figure 3 are representative of this analysis.

Figure 3. S1PR1 antibody screening by immunofluorescence.

SK-HEP-1 WT and S1PR1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio in a 96-well plate with optically clear flat-bottom. Cells were stained with the indicated S1PR1 antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody including DAPI. Acquisition of the blue (nucleus-DAPI), green (identification of WT wells), red (antibody staining) and far-red (identification of KO cells) channels was performed. Representative images of the merged blue and red (grayscale) channels are shown. WT and KO cells are outlined with green and magenta dashed line, respectively. When an antibody was recommended for immunofluorescence by the supplier, we tested it at the recommended dilution. The rest of the antibodies were tested at 1 and 2 μg/ml and the final concentration was selected based on the detection range of the microscope used and a quantitative analysis not shown here. Antibody dilution used: ab233386** at 1/400, A12935 at 1/1000, ARP80838 at 1/250., NBP2-67129** at 1/1000, 63335** at 1/2000, 55133-1-AP at 1/500, MA5-32587** at 1/1000, MA5-35431** at 1/300, MA5-38484* at 1/200. Bars = 10 μm. *Monoclonal antibody, **Recombinant antibody.

In conclusion, we have screened nine S1PR1 commercial antibodies by western blot, immunoprecipitation, and immunofluorescence by comparing the signal produced by the antibodies in human SK-HEP-1 WT and S1PR1 KO cells. To guide viewers in assessing the results in each application, Table 3 illustrates the various scenarios in which an antibody can perform and the corresponding outcomes interpreted across all three applications (Table 3).⁸ Several high-quality antibodies that successfully detect S1PR1 under our standardized experimental protocol can be identified. Researchers who wish to study S1PR1 in a different species are encouraged to select high-quality antibodies, based on the results of this study, and investigate the predicted species reactivity of the manufacturer before extending their research.

Table 3. Illustrations to assess antibody performance in all three applications.

Western blot	Immunoprecipitation	Immunofluorescence

The underlying data for this study can be found on Zenodo, an open-access repository for which YCharOS has its own collection of antibody characterization reports.¹⁸^,¹⁹

Methods

The standardized protocols used to carry out this KO cell line-based antibody characterization platform was established and approved by a collaborative group of academics, industry researchers and antibody manufacturers. The detailed materials and step-by-step protocols used to characterize antibodies in western blot, immunoprecipitation and immunofluorescence are openly available on Protocol Exchange, a preprint server (DOI: 10.21203/rs.3.pex-2607/v1).¹¹ Brief descriptions of the experimental setup used to carry out this study can be found below.

Antibodies and cell line used

Cell lines used and primary antibodies tested in this study are listed in Tables 1 and 2, respectively. To ensure that the cell lines and antibodies are cited properly and can be easily identified, we have included their corresponding Research Resource Identifiers, or RRID.¹⁵^,¹⁶ SK-HEP-1 KO clone corresponding to the S1PR1 gene was generated with low passage cells at Abcam. Two guide RNAs were used to induce a deletion in the S1PR1 gene (sequence guide 1: TCAACTATGATATCATCGTC, sequence guide 2: GCTGAATATCAGCGCGGACA). Peroxidase-conjugated goat anti-rabbit and anti-mouse are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Protein A:HRP is from MilliporeSigma (cat. number P8651).

Antibody screening by western blot

SK-HEP-1 WT and S1PR1 KO (listed in Table 1) were collected in RIPA buffer (25mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) from Thermo Fisher Scientific (cat. number 89901) supplemented with 1x protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly, rocked for 30 min in a cold room, then spun at ~110,000 × g for 15 min at 4°C. Equal aliquots of 30 μg supernatants were analyzed by SDS-PAGE and western blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Western blots were performed with precast midi 4-20% Tris-Glycine polyacrylamide gels from Thermo Fisher Scientific (cat. number WXP42012BOX) ran with Tris/Glycine/SDS buffer from Bio-Rad (cat. number 1610772), loaded in Laemmli loading sample buffer from Thermo Fisher Scientific (cat. number AAJ61337AD) and transferred on nitrocellulose membranes. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated O/N at 4°C with 5% milk in TBS with 0.1% Tween 20 (TBST) from Cell Signaling Technology (cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL from Thermo Fisher Scientific (cat. number 32106) or Clarity Western ECL Substrate from Bio-Rad (cat. number 1705061) prior to detection with the iBright™ CL1500 Imaging System from Thermo Fisher Scientific (cat. number A44240).

Antibody screening by immunoprecipitation

Antibody-beads conjugates were prepared by adding 2.0 μg to 500 μl of Pierce IP Lysis Buffer from Thermo Fisher Scientific (cat. number 87788) in a microcentrifuge tube, together with 30 μl of Dynabeads protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) from Thermo Fisher Scientific (cat. number 10002D and 10004D, respectively). Tubes were rocked for ~1 hr at 4°C followed by two washes to remove unbound antibodies.

SK-HEP-1 WT were collected in Pierce IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol) supplemented with protease inhibitor. Lysates were rocked for 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. 0.5 ml aliquots at 2.0 mg/ml of lysate (1 mg) were incubated with an antibody-bead conjugate for ~1 hr at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of IP lysis buffer and processed for SDS-PAGE and western blot on precast midi 4-20% Tris-Glycine polyacrylamide gels. Protein A:HRP (MilliporeSigma, cat. number P8651) was used as a secondary detection system at a concentration of 2.0 μg/ml.

Antibody screening by immunofluorescence

SK-HEP-1 WT and S1PR1 KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated in a 96-well plate with optically clear flat-bottom (Perkin Elmer, cat. number 6055300) as a mosaic and incubated for 24 hrs in a cell culture incubator. Cells were fixed in 4% PFA (in PBS) for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0,1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0,01% Triton X-100) containing the primary S1PR1 antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS.

Images were acquired on an ImageXpress micro confocal high-content microscopy system (Molecular Devices), using a 20× NA 0.95 water immersion objective and scientific CMOS cameras, equipped with 395, 475, 555 and 635 nm solid state LED lights (lumencor Aura III light engine) and bandpass filters to excite DAPI, Cellmask Green, Alexa-555 and Cellmask Red, respectively. Images had pixel sizes of 0.68 × 0.68 microns, and a z-interval of 4 microns. For analysis and visualization, shading correction (shade only) was carried out for all images. Then, maximum intensity projections were generated using 3 z-slices. Segmentation was carried out separately on maximum intensity projections of Cellmask channels using CellPose 1.0, and masks were used to generate outlines and for intensity quantification. Figures were assembled with Adobe Illustrator.¹⁷

Limitations

Inherent limitations are associated with the antibody characterization platform employed in this study.¹¹ The authors do not claim to have expertise in S1PR1 or sphingosine-1-phosphate signalling mechanisms, which is why a brief background of the protein’s function and relevance in disease is provided. Adopting an agnostic approach, the authors perform antibody-based applications and share the results openly, leaving the analysis and interpretation up to the readers.

For the YCharOS effort, experiments are not performed in replicates. The rationale behind this approach is related to the fact that the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted.

As comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a signle cell line for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results. Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations should impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.

Data availability

Underlying data

Zenodo: Antibody Characterization Report for S1PR1, doi.org/10.5281/zenodo.10819189.¹⁸

Zenodo: Dataset for the S1PR1 antibody screening study, doi.org/10.5281/zenodo.10839647.¹⁹

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgment

We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and KO cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources, and collaboration. Members of the group can be found below. We would also like to thank the Advanced BioImaging Facility (ABIF) consortium for their image analysis pipeline development and conduction (RRID:SCR_017697). Members of each group can be found below.

NeuroSGC/YCharOS/EDDU collaborative group: Thomas M. Durcan, Aled M. Edwards, Peter S. McPherson, Chetan Raina and Wolfgang Reintsch.

ABIF consortium: Claire M. Brown and Joel Ryan.

Thank you to the Structural Genomics Consortium, a registered charity (no. 1097737), for your support on this project. The Structural Genomics Consortium receives funding from Bayer AG, Boehringer Ingelheim, Bristol-Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda.

An earlier version of this of this article can be found on Zenodo (doi: 10.5281/zenodo.10819189).

References

1. Hla T, Maciag T: An abundant transcript induced in differentiating human endothelial cells encodes a polypeptide with structural similarities to G-protein-coupled receptors. J. Biol. Chem. 1990; 265(16): 9308–9313. PubMed Abstract | Publisher Full Text
2. Lee MJ, Van Brocklyn JR, Thangada S, et al.: Sphingosine-1-phosphate as a ligand for the G protein-coupled receptor EDG-1. Science. 1998; 279(5356): 1552–1555. PubMed Abstract | Publisher Full Text
3. Bryan AM, Del Poeta M: Sphingosine-1-phosphate receptors and innate immunity. Cell. Microbiol. 2018; 20(5): e12836. PubMed Abstract | Publisher Full Text | Free Full Text
4. Pyne S, Pyne NJ: Translational aspects of sphingosine 1-phosphate biology. Trends Mol. Med. 2011; 17(8): 463–472. PubMed Abstract | Publisher Full Text
5. Wang B, Dong N, Wu D, et al.: Sphingosine 1-phosphate receptor 1 governs endothelial barrier function and angiogenesis by upregulating endoglin signaling. Ann. Transl. Med. 2022; 10(3): 136. PubMed Abstract | Publisher Full Text | Free Full Text
6. Jung Y, Lopez-Benitez J, Tognoni CM, et al.: Dysregulation of sphingosine-1-phosphate (S1P) and S1P receptor 1 signaling in the 5xFAD mouse model of Alzheimer’s disease. Brain Res. 2023; 1799: 148171. PubMed Abstract | Publisher Full Text
7. Blaho VA, Hla T: An update on the biology of sphingosine 1-phosphate receptors. J. Lipid Res. 2014; 55(8): 1596–1608. PubMed Abstract | Publisher Full Text | Free Full Text
8. Ayoubi R, Ryan J, Biddle MS, et al.: Scaling of an antibody validation procedure enables quantification of antibody performance in major research applications. elife. 2023; 12: 12. Publisher Full Text
9. Carter AJ, Kraemer O, Zwick M, et al.: Target 2035: probing the human proteome. Drug Discov. Today. 2019; 24(11): 2111–2115.
10. Licciardello MP, Workman P: The era of high-quality chemical probes. RSC Med. Chem. 2022; 13(12): 1446–1459. PubMed Abstract | Publisher Full Text | Free Full Text
11. Ayoubi R, Ryan J, Bolivar SG, et al.: A consensus platform for antibody characterization (Version 1). Protocol. Exchange. 2024. Publisher Full Text
12. Biddle MS, Virk HS: YCharOS open antibody characterisation data: Lessons learned and progress made. F1000Res. 2023; 12: 1344. PubMed Abstract | Publisher Full Text | Free Full Text
13. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text
14. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text
15. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text
16. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text
17. Stringer C, Wang T, Michaelos M, et al.: Cellpose: a generalist algorithm for cellular segmentation. Nat. Methods. 2021; 18(1):100–106. PubMed Abstract | Publisher Full Text
18. Ayoubi R, Fotouhi M, Alende C, et al.: Antibody Characterization Report for Sphingosine 1-phosphate receptor.2024; 1(S1PR1). Publisher Full Text
19. Ayoubi R, Laflamme C: Dataset for the Sphingosine 1-phosphate receptor 1 (S1PR1) antibody screening study. [Data set]. Zenodo. 2024. Publisher Full Text

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 11 Jul 2024

Author details Author details

¹ Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada

Riham Ayoubi
Roles: Data Curation, Investigation, Methodology, Validation, Visualization, Writing – Review & Editing

Maryam Fotouhi
Roles: Investigation

Charles Alende
Roles: Investigation, Validation, Visualization

Sara González Bolívar
Roles: Investigation

Kathleen Southern
Roles: Writing – Original Draft Preparation, Writing – Review & Editing

Carl Laflamme
Roles: Conceptualization, Formal Analysis, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Writing – Review & Editing

Competing interests

For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and KO cell line providers. The partners provide antibodies and KO cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABCD antibodies- ABclonal- Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific.

Grant information

This work was supported in part by the Emory-Sage-SGC TaRget Enablement to Accelerate Therapy Development for Alzheimer’s Disease (TREAT-AD) center established by the National Institute on Aging (grant no. U5AG065187). It was also supported by the Government of Canada through Genome Canada, Genome Quebec, and Ontario Genomics (grant no. OGI-210). RA is supported by a Mitacs fellowship.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (3)

version 3

Revised

Published: 24 Jan 2025, 13:792

https://doi.org/10.12688/f1000research.153244.3

version 2

Revised

Published: 05 Sep 2024, 13:792

https://doi.org/10.12688/f1000research.153244.2

version 1

Published: 11 Jul 2024, 13:792

https://doi.org/10.12688/f1000research.153244.1

© 2024 Ayoubi R et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

SEE MORE DETAILS

CITE

how to cite this article

Ayoubi R, Fotouhi M, Alende C et al. A guide to selecting high-performing antibodies for S1PR1 (UniProt ID: P21453) for use in western blot, immunoprecipitation, and immunofluorescence [version 2; peer review: 1 approved, 1 approved with reservations]. F1000Research 2024, 13:792 (https://doi.org/10.12688/f1000research.153244.2)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 2

VERSION 2

PUBLISHED 05 Sep 2024

Revised

Views

Reviewer Report 04 Nov 2024

Christian Tiede, University of Leeds, Leeds, England, UK

Approved

https://doi.org/10.5256/f1000research.170465.r328885

In this article, nine anti-S1PR1 antibodies are evaluated in WB, IP, and IF using wt and knockout SK-HEP-1 cells. The article provides a useful resource for other scientists in selecting antibodies for their applications. The methods are detailed and well described and easy for the reader to repeat. It is indeed disappointing, as already described by the previous reviewer, that in the IP the secondary detection reagents (ProteinA-HRP, MilliporeSigma, cat. number P8651) not only detect the primary antibody (Abcam, ab233386), but also the denatured heavy and light chain of the IP antibody. For future experiments, direct immobilization of the IP antibodies on the beads via free amines and elution at pH2 could be considered. However, in this study, despite being similar in size to the S1PR1 protein, it does not appear that detecting the heavy chain would change the conclusion of the experiment. I therefore recommend approval.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Phage display

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

CITE

Report a concern

Respond or Comment

Views

Reviewer Report 19 Sep 2024

Melissa Pitman, University of Adelaide, The University of Adelaide Faculty of Sciences (Ringgold ID: 98478), Adelaide, South Australia, Australia

Approved with Reservations

https://doi.org/10.5256/f1000research.170465.r321079

CITE

Report a concern

Author Response 24 Jan 2025

Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

24 Jan 2025

Author Response

Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with ... Continue reading Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with the link provided in the revised manuscript), we include the full antibody screening results in western blot and an analysis of antibody performance in immunofluorescence, conducted on at least 500 wild-type (WT) and knockout (KO) cells per condition.

With improved titration, antibody 63335 now demonstrates a higher signal-to-noise ratio than previously shown and is fully suitable for detecting S1PR1 in western blot. The immunofluorescence analysis provides a more direct comparison of performance between antibodies and highlights the variability of S1PR1 expression across the cell population.

We hope these additional data adequately address your concerns.

Best regards,
Carl Laflamme
Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with the link provided in the revised manuscript), we include the full antibody screening results in western blot and an analysis of antibody performance in immunofluorescence, conducted on at least 500 wild-type (WT) and knockout (KO) cells per condition.

With improved titration, antibody 63335 now demonstrates a higher signal-to-noise ratio than previously shown and is fully suitable for detecting S1PR1 in western blot. The immunofluorescence analysis provides a more direct comparison of performance between antibodies and highlights the variability of S1PR1 expression across the cell population.

We hope these additional data adequately address your concerns.

Best regards,
Carl Laflamme
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 24 Jan 2025

Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

24 Jan 2025

Author Response

Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with ... Continue reading Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with the link provided in the revised manuscript), we include the full antibody screening results in western blot and an analysis of antibody performance in immunofluorescence, conducted on at least 500 wild-type (WT) and knockout (KO) cells per condition.

With improved titration, antibody 63335 now demonstrates a higher signal-to-noise ratio than previously shown and is fully suitable for detecting S1PR1 in western blot. The immunofluorescence analysis provides a more direct comparison of performance between antibodies and highlights the variability of S1PR1 expression across the cell population.

We hope these additional data adequately address your concerns.

Best regards,
Carl Laflamme
Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with the link provided in the revised manuscript), we include the full antibody screening results in western blot and an analysis of antibody performance in immunofluorescence, conducted on at least 500 wild-type (WT) and knockout (KO) cells per condition.

With improved titration, antibody 63335 now demonstrates a higher signal-to-noise ratio than previously shown and is fully suitable for detecting S1PR1 in western blot. The immunofluorescence analysis provides a more direct comparison of performance between antibodies and highlights the variability of S1PR1 expression across the cell population.

We hope these additional data adequately address your concerns.

Best regards,
Carl Laflamme
Competing Interests: No competing interests were disclosed. Close
Report a concern

Version 1

VERSION 1

PUBLISHED 11 Jul 2024

Views

Reviewer Report 05 Aug 2024

Melissa Pitman, University of Adelaide, The University of Adelaide Faculty of Sciences (Ringgold ID: 98478), Adelaide, South Australia, Australia

Not Approved

https://doi.org/10.5256/f1000research.168111.r302715

This paper used the WT and S1PR1 knockout SK-HEP-1 cells to evaluate the quality of the anti-S1PR1 antibodies obtained from different companies in three different applications, i.e. WB, IP, and IF. The results could be a useful guide for other scientists to help identify antibodies that are validated for their experimental application.

General comments:
-REQUIRED CHANGE: In the introduction there is one single line that indicates a role for S1PR1 only in neuronal events. S1PR1 has many roles throughout the body and this background needs to reflect that.
-REQUIRED CHANGE: It is unclear from the methods (in the paper or the linked protocols) and figure legends how many times these experiments were conducted. Please include the number of experiments (n=?) in the figure legends. Three independent experiments is the standard for most scientific studies.
-There are a number of published papers from the ABIF consortium with the same format. While understandable for such a multi-pronged study, some of the wording is identical between each paper and some of the same issues are present in those other studies.
-Although the reason is explicitly stated in the manuscript, it is highly unusual for a study to not explain any interpretations of their data or make any conclusions.
-REQUIRED CHANGE: The catalog number for the Abcam S1PR1 KO cells is not included - were these made custom? Please include details on how these were made e.g. CRISPR/Cas9.

REQUIRED CHANGEs: Specific comments:
-Results: "nine antibodies were screened using a mosaic strategy." Please add further detail to this sentence as not all readers will know what this strategy means.
-Figure 1: far right gel. Please check the molecular weight markers are correct on the gel. The numbers appear to be shifted down compared to the other gel images.
-Figure 2: The immunoprecipitation experiments appear to use an anti-rabbit (ab233386) antibody to detect the S1PR1 in the western blots (after immunoprecipitation). Unfortunately, using anti-rabbit antibodies in both the blots and IPs means that the heavy and light chain will be detected by the secondary antibodies. For S1PR1 that runs around the same size as the heavy chain this means that conclusive information cannot be gained. As stated in your protocol (section 2E), if you do not have an appropriate secondary antibody from a different species then other methods may need to be considered. The authors should consider using an appropriate TrueBlot (Rockland) secondary antibody to avoid detection of heavy chain or test whether running their gels under non-denaturing conditions will move the antibody band out of the same size range as the S1PR1 target.
-Figure 2 - please include the protein quantity of lysates (ug) for the IP.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Partly
Are sufficient details of methods and materials provided to allow replication by others?

No
Are the datasets clearly presented in a useable and accessible format?

Partly

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: I work cross cancer cell biology, biochemistry and molecular biology and have experience with western blotting, immunoprecipitation and immunofluorescence techniques.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Author Response 05 Sep 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

05 Sep 2024

Author Response

Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future ... Continue reading Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future reproducibility of the antibody characterization procedure. That being said, we have replied to all of your comments (italicized) below and created a new version of the manuscript to address all concerns, when appropriate. We hope that the adjustments made meet your expectations and clarify any concerns you previously had. Please see below.

General comments:
-REQUIRED CHANGE: In the introduction there is one single line that indicates a role for S1PR1 only in neuronal events. S1PR1 has many roles throughout the body and this background needs to reflect that.

To address this concern, the authors have revisited the introduction to provide further background on the function of S1PR1 throughout the body. Please refer to version 2.

-REQUIRED CHANGE: It is unclear from the (1)methods (in the paper or the linked protocols) and figure legends how many times these experiments were conducted. Please include the number of experiments (n=?) in the figure legends. Three independent experiments is the standard for most scientific studies.

We understand the perceived concern of the lack of replicates in our study. To address this concern, as well as other concerns commonly reported from reviewers, the authors have included a limitation section that will proceed the methods section. To reiterate the rationale behind this selected approach, the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted. After careful consideration, it was determined that conducting experiments in replicates does not offer significant benefits in this context.

-There are a number of published papers from the ABIF consortium with the same format. While understandable for such a multi-pronged study, some of the wording is identical between each paper and some of the same issues are present in those other studies.

The YCharOS initiative is a consensus platform developed through collaboration with academic and industry leaders to deliver antibody characterization data for human proteins to the scientific community. The collection of antibody characterization results are seen as a collection for public good, grounded on open science principles, to address research reproducibility issues and help researchers select high-quality antibodies for their experimental needs. That being said, a common template is used to deliver such antibody characterization Data Notes to the community to ensure the procedure followed is consistent and reproducible.

-Although the reason is explicitly stated in the manuscript, it is highly unusual for a study to not explain any interpretations of their data or make any conclusions.

We understand this concern and it is why we have chosen to submit the antibody characterization data in the format of Data Notes. As explained in the F1000 article guidelines, Data Notes do not include result analyses or conclusions. Furthermore, the authors prefer to remain unbiased while being transparent with the results obtained from the experiments. To provide context for readers who do not have experience analyzing results from such characterization methods utilizing knockout or knockdown lines as controls, we have included a subsequent Table to demonstrate how one can identify successful vs unsuccessful antibodies in each application. Please refer to Table 3 in the updated submission.

-REQUIRED CHANGE: The catalog number for the Abcam S1PR1 KO cells is not included - were these made custom? Please include details on how these were made e.g. CRISPR/Cas9.

The information regarding the SK-HEP-1 S1PR1 KO cell line provided by Abcam has been included in the Results section. Specific guide RNA sequences can be found in the methods section under “Antibodies and cell line used”. Please refer to version 2.

REQUIRED CHANGEs: Specific comments:
-Results: "nine antibodies were screened using a mosaic strategy." Please add further detail to this sentence as not all readers will know what this strategy means.

That you for bringing up this concern. We understand that some readers may not have experience with IF or this method in particular, which is why we have elaborated on what the mosaic strategy entails in the proceeding sentences of the IF paragraph within the results section. The clarification is also provided in the IF methods section. Please refer to version 2.

-Figure 1: far right gel. Please check the molecular weight markers are correct on the gel. The numbers appear to be shifted down compared to the other gel images.

After checking the raw data for antibody MA5-38484* evaluation by western blot (Wb), we can confirm that the placement of the molecular weight markers is correct. This can also be detected by the distinct 75 kDa signal on the left side of the blot. We predict that the proteins did not migrate as far down as intended during the protein separation by SDS-PAGE, which is why the S1PR1 protein was picked up by the antibody at a higher molecular weight. That being said, it is evident from the results that this antibody would not be appropriate to select for Wb analysis (refer to Table 3) given that the signal is not lost in the KO cell line, indicating that the antibody is not specific.

-Figure 2: The immunoprecipitation experiments appear to use an anti-rabbit (ab233386) antibody to detect the S1PR1 in the western blots (after immunoprecipitation). Unfortunately, using anti-rabbit antibodies in both the blots and IPs means that the heavy and light chain will be detected by the secondary antibodies. For S1PR1 that runs around the same size as the heavy chain this means that conclusive information cannot be gained. As stated in your protocol (section 2E), if you do not have an appropriate secondary antibody from a different species then other methods may need to be considered. The authors should consider using an appropriate TrueBlot (Rockland) secondary antibody to avoid detection of heavy chain or test whether running their gels under non-denaturing conditions will move the antibody band out of the same size range as the S1PR1 target.

As stated in the troubleshooting section of the protocol 2E, to avoid cross-reactivity of the antibody with the chains, a secondary detection system that prevents these cross-reactions with unstructured immunoglobulins should be used (https://doi.org/10.21203/rs.3.pex-2607/v1). That being said, Prot A:HRP secondary detection system was used in this study. This relevant information has been included in the antibody and Wb methods sections. Please refer to version 2.

-Figure 2 - please include the protein quantity of lysates (ug) for the IP.
This information has been added IP methods section. Please refer to version 2.
Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future reproducibility of the antibody characterization procedure. That being said, we have replied to all of your comments (italicized) below and created a new version of the manuscript to address all concerns, when appropriate. We hope that the adjustments made meet your expectations and clarify any concerns you previously had. Please see below.

General comments:
-REQUIRED CHANGE: In the introduction there is one single line that indicates a role for S1PR1 only in neuronal events. S1PR1 has many roles throughout the body and this background needs to reflect that.

To address this concern, the authors have revisited the introduction to provide further background on the function of S1PR1 throughout the body. Please refer to version 2.

-REQUIRED CHANGE: It is unclear from the (1)methods (in the paper or the linked protocols) and figure legends how many times these experiments were conducted. Please include the number of experiments (n=?) in the figure legends. Three independent experiments is the standard for most scientific studies.

We understand the perceived concern of the lack of replicates in our study. To address this concern, as well as other concerns commonly reported from reviewers, the authors have included a limitation section that will proceed the methods section. To reiterate the rationale behind this selected approach, the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted. After careful consideration, it was determined that conducting experiments in replicates does not offer significant benefits in this context.

-There are a number of published papers from the ABIF consortium with the same format. While understandable for such a multi-pronged study, some of the wording is identical between each paper and some of the same issues are present in those other studies.

The YCharOS initiative is a consensus platform developed through collaboration with academic and industry leaders to deliver antibody characterization data for human proteins to the scientific community. The collection of antibody characterization results are seen as a collection for public good, grounded on open science principles, to address research reproducibility issues and help researchers select high-quality antibodies for their experimental needs. That being said, a common template is used to deliver such antibody characterization Data Notes to the community to ensure the procedure followed is consistent and reproducible.

-Although the reason is explicitly stated in the manuscript, it is highly unusual for a study to not explain any interpretations of their data or make any conclusions.

We understand this concern and it is why we have chosen to submit the antibody characterization data in the format of Data Notes. As explained in the F1000 article guidelines, Data Notes do not include result analyses or conclusions. Furthermore, the authors prefer to remain unbiased while being transparent with the results obtained from the experiments. To provide context for readers who do not have experience analyzing results from such characterization methods utilizing knockout or knockdown lines as controls, we have included a subsequent Table to demonstrate how one can identify successful vs unsuccessful antibodies in each application. Please refer to Table 3 in the updated submission.

-REQUIRED CHANGE: The catalog number for the Abcam S1PR1 KO cells is not included - were these made custom? Please include details on how these were made e.g. CRISPR/Cas9.

The information regarding the SK-HEP-1 S1PR1 KO cell line provided by Abcam has been included in the Results section. Specific guide RNA sequences can be found in the methods section under “Antibodies and cell line used”. Please refer to version 2.

REQUIRED CHANGEs: Specific comments:
-Results: "nine antibodies were screened using a mosaic strategy." Please add further detail to this sentence as not all readers will know what this strategy means.

That you for bringing up this concern. We understand that some readers may not have experience with IF or this method in particular, which is why we have elaborated on what the mosaic strategy entails in the proceeding sentences of the IF paragraph within the results section. The clarification is also provided in the IF methods section. Please refer to version 2.

-Figure 1: far right gel. Please check the molecular weight markers are correct on the gel. The numbers appear to be shifted down compared to the other gel images.

After checking the raw data for antibody MA5-38484* evaluation by western blot (Wb), we can confirm that the placement of the molecular weight markers is correct. This can also be detected by the distinct 75 kDa signal on the left side of the blot. We predict that the proteins did not migrate as far down as intended during the protein separation by SDS-PAGE, which is why the S1PR1 protein was picked up by the antibody at a higher molecular weight. That being said, it is evident from the results that this antibody would not be appropriate to select for Wb analysis (refer to Table 3) given that the signal is not lost in the KO cell line, indicating that the antibody is not specific.

-Figure 2: The immunoprecipitation experiments appear to use an anti-rabbit (ab233386) antibody to detect the S1PR1 in the western blots (after immunoprecipitation). Unfortunately, using anti-rabbit antibodies in both the blots and IPs means that the heavy and light chain will be detected by the secondary antibodies. For S1PR1 that runs around the same size as the heavy chain this means that conclusive information cannot be gained. As stated in your protocol (section 2E), if you do not have an appropriate secondary antibody from a different species then other methods may need to be considered. The authors should consider using an appropriate TrueBlot (Rockland) secondary antibody to avoid detection of heavy chain or test whether running their gels under non-denaturing conditions will move the antibody band out of the same size range as the S1PR1 target.

As stated in the troubleshooting section of the protocol 2E, to avoid cross-reactivity of the antibody with the chains, a secondary detection system that prevents these cross-reactions with unstructured immunoglobulins should be used (https://doi.org/10.21203/rs.3.pex-2607/v1). That being said, Prot A:HRP secondary detection system was used in this study. This relevant information has been included in the antibody and Wb methods sections. Please refer to version 2.

-Figure 2 - please include the protein quantity of lysates (ug) for the IP.
This information has been added IP methods section. Please refer to version 2.
Competing Interests: No competing interests were disclosed. Close
Report a concern
Respond or Comment

COMMENTS ON THIS REPORT

Author Response 05 Sep 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

05 Sep 2024

Author Response

Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future ... Continue reading Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future reproducibility of the antibody characterization procedure. That being said, we have replied to all of your comments (italicized) below and created a new version of the manuscript to address all concerns, when appropriate. We hope that the adjustments made meet your expectations and clarify any concerns you previously had. Please see below.

General comments:
-REQUIRED CHANGE: In the introduction there is one single line that indicates a role for S1PR1 only in neuronal events. S1PR1 has many roles throughout the body and this background needs to reflect that.

To address this concern, the authors have revisited the introduction to provide further background on the function of S1PR1 throughout the body. Please refer to version 2.

-REQUIRED CHANGE: It is unclear from the (1)methods (in the paper or the linked protocols) and figure legends how many times these experiments were conducted. Please include the number of experiments (n=?) in the figure legends. Three independent experiments is the standard for most scientific studies.

We understand the perceived concern of the lack of replicates in our study. To address this concern, as well as other concerns commonly reported from reviewers, the authors have included a limitation section that will proceed the methods section. To reiterate the rationale behind this selected approach, the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted. After careful consideration, it was determined that conducting experiments in replicates does not offer significant benefits in this context.

-There are a number of published papers from the ABIF consortium with the same format. While understandable for such a multi-pronged study, some of the wording is identical between each paper and some of the same issues are present in those other studies.

The YCharOS initiative is a consensus platform developed through collaboration with academic and industry leaders to deliver antibody characterization data for human proteins to the scientific community. The collection of antibody characterization results are seen as a collection for public good, grounded on open science principles, to address research reproducibility issues and help researchers select high-quality antibodies for their experimental needs. That being said, a common template is used to deliver such antibody characterization Data Notes to the community to ensure the procedure followed is consistent and reproducible.

-Although the reason is explicitly stated in the manuscript, it is highly unusual for a study to not explain any interpretations of their data or make any conclusions.

We understand this concern and it is why we have chosen to submit the antibody characterization data in the format of Data Notes. As explained in the F1000 article guidelines, Data Notes do not include result analyses or conclusions. Furthermore, the authors prefer to remain unbiased while being transparent with the results obtained from the experiments. To provide context for readers who do not have experience analyzing results from such characterization methods utilizing knockout or knockdown lines as controls, we have included a subsequent Table to demonstrate how one can identify successful vs unsuccessful antibodies in each application. Please refer to Table 3 in the updated submission.

-REQUIRED CHANGE: The catalog number for the Abcam S1PR1 KO cells is not included - were these made custom? Please include details on how these were made e.g. CRISPR/Cas9.

The information regarding the SK-HEP-1 S1PR1 KO cell line provided by Abcam has been included in the Results section. Specific guide RNA sequences can be found in the methods section under “Antibodies and cell line used”. Please refer to version 2.

REQUIRED CHANGEs: Specific comments:
-Results: "nine antibodies were screened using a mosaic strategy." Please add further detail to this sentence as not all readers will know what this strategy means.

That you for bringing up this concern. We understand that some readers may not have experience with IF or this method in particular, which is why we have elaborated on what the mosaic strategy entails in the proceeding sentences of the IF paragraph within the results section. The clarification is also provided in the IF methods section. Please refer to version 2.

-Figure 1: far right gel. Please check the molecular weight markers are correct on the gel. The numbers appear to be shifted down compared to the other gel images.

After checking the raw data for antibody MA5-38484* evaluation by western blot (Wb), we can confirm that the placement of the molecular weight markers is correct. This can also be detected by the distinct 75 kDa signal on the left side of the blot. We predict that the proteins did not migrate as far down as intended during the protein separation by SDS-PAGE, which is why the S1PR1 protein was picked up by the antibody at a higher molecular weight. That being said, it is evident from the results that this antibody would not be appropriate to select for Wb analysis (refer to Table 3) given that the signal is not lost in the KO cell line, indicating that the antibody is not specific.

-Figure 2: The immunoprecipitation experiments appear to use an anti-rabbit (ab233386) antibody to detect the S1PR1 in the western blots (after immunoprecipitation). Unfortunately, using anti-rabbit antibodies in both the blots and IPs means that the heavy and light chain will be detected by the secondary antibodies. For S1PR1 that runs around the same size as the heavy chain this means that conclusive information cannot be gained. As stated in your protocol (section 2E), if you do not have an appropriate secondary antibody from a different species then other methods may need to be considered. The authors should consider using an appropriate TrueBlot (Rockland) secondary antibody to avoid detection of heavy chain or test whether running their gels under non-denaturing conditions will move the antibody band out of the same size range as the S1PR1 target.

As stated in the troubleshooting section of the protocol 2E, to avoid cross-reactivity of the antibody with the chains, a secondary detection system that prevents these cross-reactions with unstructured immunoglobulins should be used (https://doi.org/10.21203/rs.3.pex-2607/v1). That being said, Prot A:HRP secondary detection system was used in this study. This relevant information has been included in the antibody and Wb methods sections. Please refer to version 2.

-Figure 2 - please include the protein quantity of lysates (ug) for the IP.
This information has been added IP methods section. Please refer to version 2.
Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future reproducibility of the antibody characterization procedure. That being said, we have replied to all of your comments (italicized) below and created a new version of the manuscript to address all concerns, when appropriate. We hope that the adjustments made meet your expectations and clarify any concerns you previously had. Please see below.

General comments:
-REQUIRED CHANGE: In the introduction there is one single line that indicates a role for S1PR1 only in neuronal events. S1PR1 has many roles throughout the body and this background needs to reflect that.

To address this concern, the authors have revisited the introduction to provide further background on the function of S1PR1 throughout the body. Please refer to version 2.

-REQUIRED CHANGE: It is unclear from the (1)methods (in the paper or the linked protocols) and figure legends how many times these experiments were conducted. Please include the number of experiments (n=?) in the figure legends. Three independent experiments is the standard for most scientific studies.

We understand the perceived concern of the lack of replicates in our study. To address this concern, as well as other concerns commonly reported from reviewers, the authors have included a limitation section that will proceed the methods section. To reiterate the rationale behind this selected approach, the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted. After careful consideration, it was determined that conducting experiments in replicates does not offer significant benefits in this context.

-There are a number of published papers from the ABIF consortium with the same format. While understandable for such a multi-pronged study, some of the wording is identical between each paper and some of the same issues are present in those other studies.

The YCharOS initiative is a consensus platform developed through collaboration with academic and industry leaders to deliver antibody characterization data for human proteins to the scientific community. The collection of antibody characterization results are seen as a collection for public good, grounded on open science principles, to address research reproducibility issues and help researchers select high-quality antibodies for their experimental needs. That being said, a common template is used to deliver such antibody characterization Data Notes to the community to ensure the procedure followed is consistent and reproducible.

-Although the reason is explicitly stated in the manuscript, it is highly unusual for a study to not explain any interpretations of their data or make any conclusions.

We understand this concern and it is why we have chosen to submit the antibody characterization data in the format of Data Notes. As explained in the F1000 article guidelines, Data Notes do not include result analyses or conclusions. Furthermore, the authors prefer to remain unbiased while being transparent with the results obtained from the experiments. To provide context for readers who do not have experience analyzing results from such characterization methods utilizing knockout or knockdown lines as controls, we have included a subsequent Table to demonstrate how one can identify successful vs unsuccessful antibodies in each application. Please refer to Table 3 in the updated submission.

-REQUIRED CHANGE: The catalog number for the Abcam S1PR1 KO cells is not included - were these made custom? Please include details on how these were made e.g. CRISPR/Cas9.

The information regarding the SK-HEP-1 S1PR1 KO cell line provided by Abcam has been included in the Results section. Specific guide RNA sequences can be found in the methods section under “Antibodies and cell line used”. Please refer to version 2.

REQUIRED CHANGEs: Specific comments:
-Results: "nine antibodies were screened using a mosaic strategy." Please add further detail to this sentence as not all readers will know what this strategy means.

That you for bringing up this concern. We understand that some readers may not have experience with IF or this method in particular, which is why we have elaborated on what the mosaic strategy entails in the proceeding sentences of the IF paragraph within the results section. The clarification is also provided in the IF methods section. Please refer to version 2.

-Figure 1: far right gel. Please check the molecular weight markers are correct on the gel. The numbers appear to be shifted down compared to the other gel images.

After checking the raw data for antibody MA5-38484* evaluation by western blot (Wb), we can confirm that the placement of the molecular weight markers is correct. This can also be detected by the distinct 75 kDa signal on the left side of the blot. We predict that the proteins did not migrate as far down as intended during the protein separation by SDS-PAGE, which is why the S1PR1 protein was picked up by the antibody at a higher molecular weight. That being said, it is evident from the results that this antibody would not be appropriate to select for Wb analysis (refer to Table 3) given that the signal is not lost in the KO cell line, indicating that the antibody is not specific.

-Figure 2: The immunoprecipitation experiments appear to use an anti-rabbit (ab233386) antibody to detect the S1PR1 in the western blots (after immunoprecipitation). Unfortunately, using anti-rabbit antibodies in both the blots and IPs means that the heavy and light chain will be detected by the secondary antibodies. For S1PR1 that runs around the same size as the heavy chain this means that conclusive information cannot be gained. As stated in your protocol (section 2E), if you do not have an appropriate secondary antibody from a different species then other methods may need to be considered. The authors should consider using an appropriate TrueBlot (Rockland) secondary antibody to avoid detection of heavy chain or test whether running their gels under non-denaturing conditions will move the antibody band out of the same size range as the S1PR1 target.

As stated in the troubleshooting section of the protocol 2E, to avoid cross-reactivity of the antibody with the chains, a secondary detection system that prevents these cross-reactions with unstructured immunoglobulins should be used (https://doi.org/10.21203/rs.3.pex-2607/v1). That being said, Prot A:HRP secondary detection system was used in this study. This relevant information has been included in the antibody and Wb methods sections. Please refer to version 2.

-Figure 2 - please include the protein quantity of lysates (ug) for the IP.
This information has been added IP methods section. Please refer to version 2.
Competing Interests: No competing interests were disclosed. Close
Report a concern

Comments on this article Comments (0)

Version 3

VERSION 3 PUBLISHED 11 Jul 2024

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2	3
Version 3 (revision) 24 Jan 25			read
Version 2 (revision) 05 Sep 24	read	read
Version 1 11 Jul 24	read

Melissa Pitman, The University of Adelaide Faculty of Sciences (Ringgold ID: 98478), Adelaide, Australia
Christian Tiede, University of Leeds, Leeds, UK
Jieya Shao, Washington University in St Louis, St. Louis, USA

Comments on this article

All Comments(0)

Add a comment

Browse by related subjects

Back to all reports

Reviewer Report

6 Views

24 Apr 2025 | for Version 3

Jieya Shao, Washington University in St Louis, St. Louis, USA

6 Views Cite this report Responses(0)

Approved

In this article the authors systematically compared the performance and specificity of nine commercial anti-S1PR1 antibodies using three standard experimental approaches (Western blot, immunoprecipitation, immunofluorescence staining). This study is part of a large collaborative initiative to characterize commercial antibodies for different human proteins and offer unbiased guidance to researchers who can select the best antibodies for their specific experimental objectives based on their own interpretations. As a Data Note, this paper successfully achieved its goal with rigorously collected high-quality data, and the results are self-explanatory and useful for the research community.

One typo was found on page 3 in the first sentence of the last paragraph. The word "rain" seems to be mistakenly used instead of "run". Another minor suggestion regarding Figure 3 is that the authors can arrange the nine panels into a 3x3 format which makes full use of the space.

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

DNA damage response, DNA replication stress, cancer biology, chemotherapy

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

5 Views

04 Nov 2024 | for Version 2

Christian Tiede, University of Leeds, Leeds, England, UK

5 Views Cite this report Responses(0)

Approved

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Yes
Are sufficient details of methods and materials provided to allow replication by others?

Yes
Are the datasets clearly presented in a useable and accessible format?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Phage display

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

20 Views

19 Sep 2024 | for Version 2

Melissa Pitman, University of Adelaide, The University of Adelaide Faculty of Sciences (Ringgold ID: 98478), Adelaide, South Australia, Australia

20 Views Cite this report Responses(1)

Approved With Reservations

The authors have tried to address all of the comments. They have clearly stated the limitations to their study.

For the record, while I agree that conducting orthologous experiments and being careful with experimental set-ups can help reduce variability, I would argue that biological experiments will nearly always have some variability and should always be repeated more than once.

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

I work across cancer cell biology, biochemistry and molecular biology and have experience with western blotting, immunoprecipitation and immunofluorescence techniques.

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Respond to this report

Responses (1)

Author Response

24 Jan 2025

Carl Laflamme, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

Dear Dr. Pitman,

Thank you for your follow-up comments regarding experimental reproducibility. We have repeated the antibody screening and, as detailed in the extended data available on Zenodo (with the link provided in the revised manuscript), we include the full antibody screening results in western blot and an analysis of antibody performance in immunofluorescence, conducted on at least 500 wild-type (WT) and knockout (KO) cells per condition.

With improved titration, antibody 63335 now demonstrates a higher signal-to-noise ratio than previously shown and is fully suitable for detecting S1PR1 in western blot. The immunofluorescence analysis provides a more direct comparison of performance between antibodies and highlights the variability of S1PR1 expression across the cell population.

We hope these additional data adequately address your concerns.

Best regards,
Carl Laflamme

View more View less

Competing Interests

No competing interests were disclosed.

Back to all reports

Reviewer Report

22 Views

05 Aug 2024 | for Version 1

Melissa Pitman, University of Adelaide, The University of Adelaide Faculty of Sciences (Ringgold ID: 98478), Adelaide, South Australia, Australia

22 Views Cite this report Responses(1)

Not Approved

Is the rationale for creating the dataset(s) clearly described?

Yes
Are the protocols appropriate and is the work technically sound?

Partly
Are sufficient details of methods and materials provided to allow replication by others?

No
Are the datasets clearly presented in a useable and accessible format?

Partly

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

I work cross cancer cell biology, biochemistry and molecular biology and have experience with western blotting, immunoprecipitation and immunofluorescence techniques.

Respond to this report

Responses (1)

Author Response

05 Sep 2024

Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada

Thank you to Melissa Pitman for your comprehensive review of this manuscript. The authors have taken great consideration from all suggested changes and made the necessary changes to ensure future reproducibility of the antibody characterization procedure. That being said, we have replied to all of your comments (italicized) below and created a new version of the manuscript to address all concerns, when appropriate. We hope that the adjustments made meet your expectations and clarify any concerns you previously had. Please see below.

General comments:
-REQUIRED CHANGE: In the introduction there is one single line that indicates a role for S1PR1 only in neuronal events. S1PR1 has many roles throughout the body and this background needs to reflect that.

To address this concern, the authors have revisited the introduction to provide further background on the function of S1PR1 throughout the body. Please refer to version 2.

-REQUIRED CHANGE: It is unclear from the (1)methods (in the paper or the linked protocols) and figure legends how many times these experiments were conducted. Please include the number of experiments (n=?) in the figure legends. Three independent experiments is the standard for most scientific studies.

We understand the perceived concern of the lack of replicates in our study. To address this concern, as well as other concerns commonly reported from reviewers, the authors have included a limitation section that will proceed the methods section. To reiterate the rationale behind this selected approach, the validation of the KO cell lines involves the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line at a concentration that is detectible by a suitable antibody and supports conclusions regarding the specificity of the other antibodies. Typically, we have access to the same antibody from 2-3 manufacturers (cross-licensed antibodies), which effectively serve as replicates, enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted. After careful consideration, it was determined that conducting experiments in replicates does not offer significant benefits in this context.

-There are a number of published papers from the ABIF consortium with the same format. While understandable for such a multi-pronged study, some of the wording is identical between each paper and some of the same issues are present in those other studies.

The YCharOS initiative is a consensus platform developed through collaboration with academic and industry leaders to deliver antibody characterization data for human proteins to the scientific community. The collection of antibody characterization results are seen as a collection for public good, grounded on open science principles, to address research reproducibility issues and help researchers select high-quality antibodies for their experimental needs. That being said, a common template is used to deliver such antibody characterization Data Notes to the community to ensure the procedure followed is consistent and reproducible.

-Although the reason is explicitly stated in the manuscript, it is highly unusual for a study to not explain any interpretations of their data or make any conclusions.

We understand this concern and it is why we have chosen to submit the antibody characterization data in the format of Data Notes. As explained in the F1000 article guidelines, Data Notes do not include result analyses or conclusions. Furthermore, the authors prefer to remain unbiased while being transparent with the results obtained from the experiments. To provide context for readers who do not have experience analyzing results from such characterization methods utilizing knockout or knockdown lines as controls, we have included a subsequent Table to demonstrate how one can identify successful vs unsuccessful antibodies in each application. Please refer to Table 3 in the updated submission.

-REQUIRED CHANGE: The catalog number for the Abcam S1PR1 KO cells is not included - were these made custom? Please include details on how these were made e.g. CRISPR/Cas9.

The information regarding the SK-HEP-1 S1PR1 KO cell line provided by Abcam has been included in the Results section. Specific guide RNA sequences can be found in the methods section under “Antibodies and cell line used”. Please refer to version 2.

REQUIRED CHANGEs: Specific comments:
-Results: "nine antibodies were screened using a mosaic strategy." Please add further detail to this sentence as not all readers will know what this strategy means.

That you for bringing up this concern. We understand that some readers may not have experience with IF or this method in particular, which is why we have elaborated on what the mosaic strategy entails in the proceeding sentences of the IF paragraph within the results section. The clarification is also provided in the IF methods section. Please refer to version 2.

-Figure 1: far right gel. Please check the molecular weight markers are correct on the gel. The numbers appear to be shifted down compared to the other gel images.

After checking the raw data for antibody MA5-38484* evaluation by western blot (Wb), we can confirm that the placement of the molecular weight markers is correct. This can also be detected by the distinct 75 kDa signal on the left side of the blot. We predict that the proteins did not migrate as far down as intended during the protein separation by SDS-PAGE, which is why the S1PR1 protein was picked up by the antibody at a higher molecular weight. That being said, it is evident from the results that this antibody would not be appropriate to select for Wb analysis (refer to Table 3) given that the signal is not lost in the KO cell line, indicating that the antibody is not specific.

-Figure 2: The immunoprecipitation experiments appear to use an anti-rabbit (ab233386) antibody to detect the S1PR1 in the western blots (after immunoprecipitation). Unfortunately, using anti-rabbit antibodies in both the blots and IPs means that the heavy and light chain will be detected by the secondary antibodies. For S1PR1 that runs around the same size as the heavy chain this means that conclusive information cannot be gained. As stated in your protocol (section 2E), if you do not have an appropriate secondary antibody from a different species then other methods may need to be considered. The authors should consider using an appropriate TrueBlot (Rockland) secondary antibody to avoid detection of heavy chain or test whether running their gels under non-denaturing conditions will move the antibody band out of the same size range as the S1PR1 target.

As stated in the troubleshooting section of the protocol 2E, to avoid cross-reactivity of the antibody with the chains, a secondary detection system that prevents these cross-reactions with unstructured immunoglobulins should be used (https://doi.org/10.21203/rs.3.pex-2607/v1). That being said, Prot A:HRP secondary detection system was used in this study. This relevant information has been included in the antibody and Wb methods sections. Please refer to version 2.

-Figure 2 - please include the protein quantity of lysates (ug) for the IP.
This information has been added IP methods section. Please refer to version 2.

View more View less

Competing Interests

No competing interests were disclosed.

Alongside their report, reviewers assign a status to the article:

Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested

Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.

Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions

[1] 1. Hla T, Maciag T: An abundant transcript induced in differentiating human endothelial cells encodes a polypeptide with structural similarities to G-protein-coupled receptors. J. Biol. Chem. 1990; 265(16): 9308–9313. PubMed Abstract | Publisher Full Text

[2] 2. Lee MJ, Van Brocklyn JR, Thangada S, et al.: Sphingosine-1-phosphate as a ligand for the G protein-coupled receptor EDG-1. Science. 1998; 279(5356): 1552–1555. PubMed Abstract | Publisher Full Text

[3] 3. Bryan AM, Del Poeta M: Sphingosine-1-phosphate receptors and innate immunity. Cell. Microbiol. 2018; 20(5): e12836. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Pyne S, Pyne NJ: Translational aspects of sphingosine 1-phosphate biology. Trends Mol. Med. 2011; 17(8): 463–472. PubMed Abstract | Publisher Full Text

[5] 5. Wang B, Dong N, Wu D, et al.: Sphingosine 1-phosphate receptor 1 governs endothelial barrier function and angiogenesis by upregulating endoglin signaling. Ann. Transl. Med. 2022; 10(3): 136. PubMed Abstract | Publisher Full Text | Free Full Text

[6] 6. Jung Y, Lopez-Benitez J, Tognoni CM, et al.: Dysregulation of sphingosine-1-phosphate (S1P) and S1P receptor 1 signaling in the 5xFAD mouse model of Alzheimer’s disease. Brain Res. 2023; 1799: 148171. PubMed Abstract | Publisher Full Text

[7] 7. Blaho VA, Hla T: An update on the biology of sphingosine 1-phosphate receptors. J. Lipid Res. 2014; 55(8): 1596–1608. PubMed Abstract | Publisher Full Text | Free Full Text

[8] 8. Ayoubi R, Ryan J, Biddle MS, et al.: Scaling of an antibody validation procedure enables quantification of antibody performance in major research applications. elife. 2023; 12: 12. Publisher Full Text

[9] 9. Carter AJ, Kraemer O, Zwick M, et al.: Target 2035: probing the human proteome. Drug Discov. Today. 2019; 24(11): 2111–2115.

[10] 10. Licciardello MP, Workman P: The era of high-quality chemical probes. RSC Med. Chem. 2022; 13(12): 1446–1459. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. Ayoubi R, Ryan J, Bolivar SG, et al.: A consensus platform for antibody characterization (Version 1). Protocol. Exchange. 2024. Publisher Full Text

[12] 12. Biddle MS, Virk HS: YCharOS open antibody characterisation data: Lessons learned and progress made. F1000Res. 2023; 12: 1344. PubMed Abstract | Publisher Full Text | Free Full Text

[13] 13. Laflamme C, McKeever PM, Kumar R, et al.: Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8: 8. Publisher Full Text

[14] 14. Alshafie W, Fotouhi M, Shlaifer I, et al.: Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11: 977. Publisher Full Text

[15] 15. Bandrowski A, Pairish M, Eckmann P, et al.: The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51(D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text

[16] 16. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29(2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text

[17] 17. Stringer C, Wang T, Michaelos M, et al.: Cellpose: a generalist algorithm for cellular segmentation. Nat. Methods. 2021; 18(1):100–106. PubMed Abstract | Publisher Full Text

[18] 18. Ayoubi R, Fotouhi M, Alende C, et al.: Antibody Characterization Report for Sphingosine 1-phosphate receptor.2024; 1(S1PR1). Publisher Full Text

[19] 19. Ayoubi R, Laflamme C: Dataset for the Sphingosine 1-phosphate receptor 1 (S1PR1) antibody screening study. [Data set]. Zenodo. 2024. Publisher Full Text

A guide to selecting high-performing antibodies for S1PR1 (UniProt ID: P21453) for use in western blot, immunoprecipitation, and immunofluorescence

Abstract

Keywords

Revised Amendments from Version 1

Introduction

Results and discussion

Table 1. Summary of the cell lines used.

Table 2. Summary of the S1PR1 antibodies tested.

Figure 1. S1PR1 antibody screening by western blot.

Figure 2. S1PR1 antibody screening by immunoprecipitation.

Figure 3. S1PR1 antibody screening by immunofluorescence.

Table 3. Illustrations to assess antibody performance in all three applications.

Methods

Antibodies and cell line used

Antibody screening by western blot

Antibody screening by immunoprecipitation

Antibody screening by immunofluorescence

Limitations

Data availability

Underlying data

Acknowledgment

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated