ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro

[version 2; peer review: 2 approved, 2 approved with reservations]
PUBLISHED 26 Mar 2026
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

This article is included in the Cell & Molecular Biology gateway.

This article is included in the Oncology gateway.

Abstract

Background

Pancreatic cancer has a poor prognosis and is highly aggressive and deadly. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases. Developing effective therapeutic strategies requires an understanding of the molecular mechanisms associated with pancreatic cancer progression. Small nucleolar RNA 64 (SNORA64) was presented as a predictive marker for pancreatic cancer stages in our previous study. SNORA64 showed a gradual loss of its expression throughout the carcinogenesis process, and it inhibited metastasis by interfering with epithelial to mesenchymal transition (EMT). In this study, we investigated the role of SNORA64 on an intrinsic apoptotic pathway in pancreatic cancers by using human pancreatic cell line derived from adenocarcinoma PK-8 with SNORA64 knockdown and the scramble to compare with.

Methods

QPCR techniques used to measure the gene expression level of apoptosis related genes and cell viability assay using trypan blue exclusion are implanted in this study as investigational methods.

Results

Pk-8 SNORA64 knockdown shows a significant low expression of tumor suppressor P53 in contrast to the scramble control cell line. Pk-8 SNORA64 knockdown shows significantly high expression of anti-apoptotic genes B-cell leukemia/lymphoma-2 (BCl2) and B-cell lymphoma-extra-large (BCL-Xl) in contrast to the scramble control cell line. Conversely, the pro-apoptotic genes BH3 interacting domain death agonist (BID), BCL2 Associated X (BAX), and BCL2 homologous antagonist/killer (BAK) show significantly low expression compared to the scramble control. However, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line. Furthermore, the Pk-8 with SNORA64 knockdown shows a significant high proliferation rate and viability percentage compared to the scramble control cell line.

Conclusion

The downregulation of SNORA64 affects apoptosis pathways by manipulating pro- and anti-apoptotic gene regulators. The SNORA64 interactions with apoptotic inhibitor molecules and downregulation of pro-apoptotic molecules significantly sustain cellular viability. Therefore; SNORA64 may serve as a sensitizer to apoptosis-inducing therapies.

Keywords

Apoptosis, Pancreatic Cancer, Cellular viability, Regulator genes, SNORA64

Revised Amendments from Version 1

The revised version of the manuscript incorporates the corrections suggested by the reviewers. The abstract has been refined to specify the key techniques employed and now explicitly presents the main findings, with the potential therapeutic implications articulated more clearly. The introduction has been restructured to directly introduce pancreatic cancer and explicitly justify the current functional investigation into apoptosis, thereby creating a smoother transition from the background context to the study objectives while maintaining consistent language throughout the manuscript. Within the materials and methods section, several specifications have been added, including details regarding the small RNA used for knockdown, clarification of agarose gel utilization for qPCR product verification, modification of the table design, and identification of the software employed for statistical analysis. The discussion has undergone substantial revision, incorporating additional sentences addressing p53 downregulation, a refocused paragraph examining the BCL2 family encompassing both pro- and anti-apoptotic molecules, expanded commentary on the connection between the caspase cascade and the BCL2 pathway, rephrased and elaborated content regarding increased cell viability, a newly added paragraph specifically discussing BIM and BAD, integration of a mechanistic speculation section, and the inclusion of a new limitations subsection.

See the author's detailed response to the review by Tingbo Liang
See the author's detailed response to the review by Adeolu Oluremi

1. Introduction

This Adenocarcinoma and neuroendocrine pancreatic cancer are two major types of pancreatic cancer. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases and originate in the pancreas’ duct lining.1 There are limited treatment options for pancreatic cancer, because of its aggressive and lethal nature, it has a dismal prognosis. In order to develop effective therapeutic strategies for pancreatic cancer, it is essential to understand the molecular mechanisms involved in its progression.2 Cancer cells, however, are often able to escape cell death and continue to proliferate in pancreatic cancer due to the deregulation of the apoptosis pathway.1 The process of apoptosis, or programmed cell death, maintains tissue homeostasis and prevents cancer triggered by several stimuli. During early development and in pathophysiological conditions, programmed cell death plays a key role in maintaining morphogenetic homeostasis.3 The development and progression of cancer are associated with the deregulation of different apoptotic components.2 Apoptosis requires the activation of distinct signaling pathways that are frequently deregulated by cancer, such as tumor suppressor P53.3 P53 is the most common genetic alteration found in clinical tumor samples, and there’s a positive statistical association between its expression and apoptosis.4 It may therefore be possible to track the progression of cancer by investigating the single or multiple apoptotic components involved in its expression during carcinogenesis.2 DNA damage and oxidative stress are examples of internal, or so-called mitochondrial stimuli that can also affect apoptosis (as well as external stimuli).2,3 In the intrinsic apoptotic pathway, members of the B-cell leukemia/lymphoma-2 (BCl2) family include groups of genes known as pro- or antiapoptotic proteins. Apoptosis activation is relatively dependent on the balance between the expression of these genes. There are anti-apoptotic regulators (BCl2, BCL-XL, BCLDW, and MCL-1), pro-apoptotic BH3-only regulators that act as apoptotic sensitizers (BAD, NOXA, HRK, BIK, BMF), pro-apoptotic BH3-only regulators that act as apoptotic activators (BID, BIM, and PUMA), and pore-forming regulators that act as effectors (BAX, BAK).3 Specifically, the BCl2 family of proteins is responsible for regulating mitochondrial outer membrane permeabilization. Any change in mitochondrial outer membrane permeabilization leads to the irreversible release of intermembrane space proteins such as Cytochrome c (Cyt.c).5 The latter is a water-soluble protein released from the mitochondrial membrane in the cytoplasm and initiates the executive apoptotic pathways, such as activates the execution pathway mediated by caspase enzymes. Several cancer types have been associated with Cyt.c as a prognostic indicator of apoptosis, based on the data available so far. Researchers discovered that NS398 medications were linked to the suppression of Cyclo-oxygenase-2 (COX-2) production in esophageal cancer cells via a cyt. c-dependent pathway.6 In a similar study, teniposide increased Cyt. c expression in a dose-dependent manner, indicating that it affected anticancer drug resistance and induced programmed cell death in cancerous cells. Upon release from the mitochondrial membrane in the cytoplasm, Cyt. c activates procaspase-9 which has a proteolytic activity.7 In the intrinsic apoptosis pathway, procaspase-9 is an initiator caspase that is present in a monomer form and consists of three domains.3 In the event of caspase-9 activation, it cleaves and activates executor caspase-3. It is known that caspase-3, a major component of the execution pathway, cleaves DNAase inhibitors and proteins of the cytoskeleton, causing the fragmentation of cells.3,8 It is believed that caspase-3 participates in proteolytic series by activating caspases -6, -7, and -9 to facilitate the disintegration of the apoptotic cells prior to their removal by phagocytosis.3 Generally, cell death results from the execution pathway, which is demonstrated by blebbing membranes, DNA disintegration condensed chromosomes, and cell shrinkage. Evidence suggests that deregulation of specific caspases enhances the tumorigenic potential of cells.9

One of the most prominent examples of non-coding RNAs (ncRNAs) are small nucleolar RNAs (snoRNAs). snoRNA is a small RNA molecule that typically consists of 60 to 300 nucleotides and is found primarily in the nucleus of a cell.10 In the late 1970s, snoRNA’s primary role was uncovered in research to ensure that ribosomes, the cellular machinery that synthesizes proteins, are assembled and function correctly.11 In recent years, researchers have covered a wide variety of regulatory processes, including transcription, post-transcriptional modification, and translation. However, it was found that snoRNA was significantly downregulated in meningiomas compared with normal brain tissue. This led to further investigation of the potential role of snoRNA in cancer.12 Clinical samples and cell lines have also shown that snoRNAs are expressed in a variety of malignancies, indicating that they may be used as prognostic and diagnostic indicators for diseases including breast cancer and non-small cell lung cancer (NSCLC). Among the snoRNAs that are frequently overexpressed in breast cancer, prostate cancer, and lung cancer, SNORA42, SNORD15A, SNORD15B, SNORD22, SNORD17, and SNORD87 have been demonstrated to correlate with tumorigenicity, highlighting snoRNA’s significance in regulating cancer biology.13 As demonstrated by the strong correlation between a poor clinical outcome and increased SNORD52 expression in hepatocellular carcinoma (HCC). SNORD52 increases the stability of the CDK1 protein, which in turn promotes the development of HCC. Therefore; targeting the Upf1/SNORD52/CDK1 pathway may have therapeutic potential for the treatment of HCC.14 Though their processes, particularly their functions in cellular signal transduction pathways, are not fully understood, the majority of recent reports focus on SNORAs screening and verifying their correlations with illnesses. Based on these findings, it is possible that SNORAs play an important role at the transcriptional and epigenetic levels, as well as in healthy and tumor tissues and body fluids.12,13

Small nucleolar RNA, H/ACA box 64 (SNORA64) or U64 is one of the SNORAs that enables protein binding, as evidenced by Inferred Physical Interaction (IPI). In addition, SNORA64 is involved in processing primary RNA transcripts into one or more mature RNA molecules as Inferred from Electronic Annotation (IEA).15,16 The interaction of this molecule with a number of proteins could be involved in modulating telomerase, according to some researchers.15 Further, it may serve as a potential osteoarthritis biomarker.17 According to our earlier research, there are variations in mRNA expression between the three distinct tumor grades, indicating a significant part for SNORA64 in the genesis and progression of pancreatic cancer. Furthermore, a link was observed between the reduction of SNORA64 expression and the stimulation of the epithelial-to-mesenchymal transition. These findings suggest that SNORA64 could serve as a predictive marker in pancreatic cancer.18 Due to the lack of knowledge of SNORAs’ impact on apoptotic pathways, we are currently examining how SNORA64 affects the expression of both pro- and anti-apoptotic genes in pancreatic cancer cells.

2. Material and methods

2.1 Cell line and construct

Pancreatic cancer cell line PK-8 obtained from Riken Cell Bank (RRID:CVCL_4718). PK-8 with SNORA64 knockdown and scramble cell line as a control are used in this study. siRNA oligos transmitted by psiRNA-h7SKG1 was used to knockdown the gene expression of SNORA64. The efficiency of the transfection was around 50%, as determined in our previous study.18 A humidified incubator is used for cultivation of cell lines in RPMI-1640 containing 10% fetal bovine serum (FBS), 100 u/ml of penicillin, 100 g/ml of streptomycin, and 5% carbon dioxide.

2.2 Real-time reverse transcription polymerase chain reaction (RT-PCR)

Using two sets of primers (left and right), each gene’s RNA expression was measured using RT-PCR analysis with four replicates for each sample. Gel electrophoresis utilizing ethidium bromide was employed for the confirmation of qPCR products. Data for gene sequences were obtained from the National Center for Biotechnology Information (NIH), starting with Homo sapiens tumor suppressor P53. Homo sapiens BCL2 and BCL2-related protein, long isoform (BCL-Xl) have been used as anti-apoptotic gene markers. Homo sapiens BCL2 like 11(BIM), BCL2 antagonist of cell death (BAD), BH3 interacting domain death agonist (BID), BCL2 associated X protein (BAX), and BCL2 antagonist/killer (BAK) have been used as pro-apoptotic genes. Homo sapiens CASP-9, CASP-3, and CASP-7 genes are used as indicators of the initiation of the apoptotic cascade. β-ACTIN, a housekeeping protein, is the reference gene used to normalize the amounts of mRNA ( Table 1). The Trizol technique (MRC, Cata#RT111) was used to extract total RNA, and the nanodrop spectrophotometer used to measure the RNA purity and concentration. cDNA was produced using ProtoScript® M-MuLV TaqRT-PCR kit (NEB, cat#E6400S).18 The mixture’s templet cDNA’s targeted genes were amplified using Biorad CFX96.18,19

Table 1. Left and right primer sequences used in (RT-PCR) analysis.

Gene symbol5'-Left Primer Sequence-3' 5'-Right Primer Sequence-3'
P53aggttggctctgactgtaccgattctcttcctctgtgcgc
BCL2ggaggattgtggccttctttgccgtacagttccacaaagg
BCL-Xl catggcagcagtaaagcaagtcccggaagagttcattcac
BADgaagactccagctctgcagacatcccttcgtcgtcctcc
BIDggcctaccctagagacatggtggctaagctcctcacgtag
BIMtggcccttttgctaccagataggaggacttggggtttgtg
BAXtctgacggcaacttcaactgttgaggagtctcacccaacc
BAKccaggacacagaggaggtttctctgagtcatagcgtcggt
CASP -9ctagtttgcccacacccagtcctttcaccgaaacagcatt
CASP-3tggaattgatgcgtgatgttggcaggcctgaataatgaaa
CASP -7ttccacggttccaggctattagttccttggtgagcatgga
β-ACTINagaaaatctggcaccacaccagaggcgtacagggatagca

2.3 Cell proliferation assay

Six-well plates were seeded with 2X104 SNORA64 knockdown cells of PK-8, along with scramble cell lines as a control, and incubated for six hours. Trypsin was used to collect the cells, and then medium-washed over them. The Vi-cell XR (cell viability analyzer) uses trypan blue dye to determine the quantity of viability and viable cells.

2.4 Analytical statistics

After the data were examined using Excel sheet, a two-tailed Student’s t-test was used to identify any significant differences in gene expression. P-value ≤ 0.05.

3. Results

3.1 Pk-8 SNORA64 knockdown shows a significant low expression of tumor suppressor P53

In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the expression of p53 (Figure 1).

31ead6fc-d72f-4c5e-9e27-50af0bfb6fc7_figure1.gif

Figure 1. Tumor suppressor P53 mRNA expression level in Pk-8 SNORA64 knockdown cell line.

Pk-8 with SNORA64 knockdown significantly downregulated the expression of p53 mRNA compared to the scramble control cell line. P-value was 0.01.

3.2 Pk-8 SNORA64 knockdown shows significant differences in the expression of apoptotic regulator genes

Pk-8 cell line with SNORA64 knockdown significantly upregulated the expression of anti-apoptotic regulator genes BCL2 and BCL-Xl in contrast with the scramble (Figure 2A).

31ead6fc-d72f-4c5e-9e27-50af0bfb6fc7_figure2.gif

Figure 2. Apoptotic regulators mRNA expression levels in the Pk-8 SNORA64 knockdown cell line.

A.Pk-8 with SNORA64 knockdown significantly upregulated the expression of anti-apoptotic regulator genes BCL2 and BCL-Xl in contrast with the scramble. P-value were 0.01, and 0.01respectively.

B. In comparison to the scramble control cell line, Pk-8 with SNORA64 knockdown markedly reduced the pro-apoptotic regulator genes BID, BAX, and BAK. BAD and BIM, however, do not differ from scramble cell line control in terms of expression. P-value were 0.001, 0.001, 0.001, 0.1 and 0.06 respectively.

In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the pro-apoptotic genes BID, BAX, and BAK (Figure 2B). Despite this, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line (Figure 2B).

3.3 Pk-8 SNORA64 knockdown shows significantly low expression of apoptotic enzymes

In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the expression of apoptotic enzyme genes CASP-9, 3, and 7 (Figure 3).

31ead6fc-d72f-4c5e-9e27-50af0bfb6fc7_figure3.gif

Figure 3. Apoptotic enzyme mRNA expression levels in the Pk-8 SNORA64 knockdown cell line.

Pk-8 with SNORA64 knockdown significantly downregulated the expression of apoptotic enzyme regulator genes CASP-9, 3, and 7 compared to the scramble control cell line. P-value were 0.0001, 0.002, and 0.001 respectively.

3.4 Pk-8 SNORA64 knockdown shows significant survival n in viable cells and viability

In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly elevated the number of viable cells (Figure 4A) and viability (Figure 4B).

31ead6fc-d72f-4c5e-9e27-50af0bfb6fc7_figure4.gif

Figure 4. Cellular viabilities in Pk-8 SNORA64 knockdown cell line.

A. In comparison with the scramble control cell line, Pk-8 with SNORA64 knockdown showed a significant increase in viable cells. P-value was 0.01.

B. Pk-8 with SNORA64 knockdown significantly increased the viability of the cells compared to the scramble control cell line. P-value was 0.01.

4. Discussion

Despite the limited treatment options and poor prognosis for pancreatic cancer, this disease is highly aggressive and deadly.1 One of the characteristics of pancreatic cancer that encourages initiation, growth, and therapeutic resistance is apoptosis avoidance.2,3,19 Apoptosis relies on specific signaling pathways that are often deregulated in cancer development and progression.2,3 The apoptosis pathway is cooperatively coordinated by tumor suppressor p53 signaling pathways. Epidemiological research and molecular evidence have shown that P53 mutations are associated with an increased risk of developing cancer.3,4,20 Mutations in the P53 gene compromise its function and give p53 mutants oncogenic traits, making p53 a prominent target for novel anti-cancer therapies due to its frequent mutations and inactivation in malignant tumors.4 Our results show low expression of P53 in the Pk-8 with SNORA64 knockdown expression compared to the control. It is well known that genetic alteration in the tumor suppressor P53 is common during stages of pancreatic carcinogenesis.20 By interacting with the multidomain members of the BCL2 family, p53 directly contributes to the intrinsic apoptotic pathway by inducing permeabilization of the mitochondrial outer membrane.3 Furthermore, an investigation was conducted to determine how the expression of the p53 and BCL2 proteins relates to the various kinds of human cancers.20 In the malignant tumors, there was a noteworthy negative connection observed between the expression of p53 and BCL2.10,20 According to our findings, Pk-8 has elevated BCL2 and BCL-XL expression, while SNORA64 expression is low. The BCL2 and BCL-XL dimers prevent death signals and promote cell survival.3 As pancreatic cancer progresses, BCL-XL expression rises. Treatments using anti-BCL-XL may be able to stop pancreatic tumors from progressing from their primary to more advanced stages.21 Furthermore, BCL-XL overexpression raises the incidence rates of pancreatic cancer by preventing apoptosis and senescence brought on by oncogenes.22

It is well known that the tumor suppressor gene p53 essential for maintaining genomic stability. It controls the production of the anti-apoptosis molecule BCL2 as well as the pro-apoptosis molecule BAX.4 The pro-apoptotic gene BAX and the anti-apoptotic gene BCL2 have been found to be significant participants in the control of apoptosis in pancreatic cancer.22 Conversely, this study shows a decline in the expression of the pro-apoptotic molecules BID, BAK, and BAX, while SNORA64 expression is low. BID is one of the molecules that activate BAK and BAX dimerization. BID protein is truncated in the presence of one of the intrinsic signaling apoptosis. Truncated BID can activate the effector proteins BAK and BAX. The BAK and BAX dimers bind to and sequester the anti-apoptotic BCL2 and BCL-XL.3,5 The subsequent signals have an impact on the potential of the mitochondrial membrane and result in the release of Cyt. c to the cytoplasm. Consequently, the release of Cyt. c and the activation of Casp-9 and 3 initiate the cascade of caspases.3,6 Despite this, SNORA64 knockdown showed no effect on the expression of BAD and BIM in Pk-8 with SNORA64 knockdown when compared with the scrambled control cells. The proapoptotic action of BAD protein is negatively regulated by AKT phosphorylation. In addition, BIM can directly activate BAX and BAK to initiate apoptosis due to its ability to bind and sequester BCL2 and BCL-XL protein molecules with immense affinities.5 Our findings highlight the fact that SNORA64 has no genetic expression-level impact on BAD/BIM. However, the post-transcription alteration is still a worthwhile area for future research.

Via lowering the transmembrane flux of calcium ions, BCL2 may also control apoptosis via modifying calcium channels. Ca2+ is released from the endoplasmic reticulum when pro-apoptotic molecules build up on this organelle. This release then triggers the apoptotic program by activating the initiator procaspase-12, which cleaves and activates caspase-9 and caspase-3.3,5 Casp-3 activation is thought to initiate the apoptotic execution route since it can activate Casp-6 and 7. The execution route is irreversible and constitutes the last phase of apoptosis induction.3 Many studies demonstrated the Casp-3 role in the progression, aggressiveness, and overall survival time of patients with gastric, ovarian, prostate, cervical, and colorectal cancer.2325 Furthermore, Casp-3 can suppress dissemination and invasion and promote the epithelial-to-mesenchymal transition phenotype. Casp-3 is therefore regarded as a significant prognostic marker and an indicator for cancer disease-free survival rates as well as overall 5-year survival rates.23,25 When compared to the scrambled control cells, our data demonstrate a decrease in the key caspases’ mRNA expression in the intrinsic signaling apoptosis Casp-9, 3, and 7.

The imbalance of both pro- and anti-apoptotic genes may stimulate tumor growth and progression in pancreatic cancer by increasing cell proliferation, cell viability, and decreasing cell death.1,2 Culture productivity is increased when anti-apoptosis genes, such as BCL2, are overexpressed and suppress apoptosis.5 The pro-apoptotic molecules BCL2 and BCL-XL enhance the survival duration and longevity of the cells. BCL2 regulates Ca2+ concentration, inhibits caspase (9,3,6, and 7) to prevent apoptosis and enhance malignant transformation, and BCL-XL decreases the release of mitochondrial cytochrome C.5 Our results indicated a significant increase in viable cells and viability in Pk-8 with knockdown of SNORA64 compared to the scramble. The increase of the cell survival may result from the increased expression of anti-apoptotic genes. We also recently reported that the expression of SNORA64 in pancreatic cancer tissues is significantly higher than that in normal pancreatic ductal tissues.18

Pro-apoptotic and anti-apoptotic regulator equilibrium is essential for homeostasis, and any change toward survival through a variety of escape mechanisms will encourage tumor growth.3 One of the primary methods that tumor cells develop resistance to chemotherapy and radiation treatment is through apoptosis-regulatory mediators, particularly elevated concentrations of anti-apoptotic proteins.26 Restoring apoptosis in the tumor cells resistant to chemotherapy and radiation therapy is crucial to the treatment.26,27 Therefore, SNORA64 can be used as a therapeutic agent to increase cell sensitivity to death by chemotherapy. A future step should be taken to investigate the synergistic effect of SNORA64 and chemotherapy in cancer treatment.

Several studies have demonstrated the critical role played by SNORAs in cancer development and their potential uses as biomarkers and/or therapeutic targets.1218 As a result, changes in SNORAs expression could significantly affect the pathogenic processes and pathways underlying the development of cancer. Our research shows that, among particular molecules, the SNORA64 molecule has the capacity to activate the apoptotic intrinsic pathway or enhance sensitivity to death. On the other hand, SNORA64 could be a key indicator for cell proliferation and survival. We propose that SNORA64 may influence a transcriptional or post-transcriptional regulator that coordinately modulates p53 and a subset of BCL2 family genes, but not BAD/BIM on the transcriptional level.

5. Limitation

Future work should validate findings in other pancreatic cancer cell lines and in vivo models.

6. Conclusion

Based on our findings, SNORA64 may modulate both pro-apoptotic and anti-apoptotic genes that control apoptosis. SNORA64 promotes apoptosis by increasing the expression of the apoptotic key master P53 and pro-apoptotic molecules such as BID, BAX, and BAK. Meanwhile, SNORA64 expression impact the anti-apoptosis molecules BCL2 and BCL-XL by decreasing their expression. Consequently, low expression of SNORA64 increases the viability of pancreatic cancer cells by increasing viable cells number.

Ethics information

This study was completed in accordance with Southern Technical University’s ethical guidelines with approval number 5/1863. This study did not involve human participants.

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 16 Jan 2026
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Alfardan R. Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 2; peer review: 2 approved, 2 approved with reservations]. F1000Research 2026, 15:68 (https://doi.org/10.12688/f1000research.173746.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 26 Mar 2026
Revised
Views
11
Cite
Reviewer Report 20 Apr 2026
Dheyaa Al-Sallami, Pharmacology, Southern Illinois University School of Medicine, Springfield, Illinois, USA 
Approved with Reservations
VIEWS 11
The paper addresses a genuinely underexplored question — the role of a specific H/ACA snoRNA in pancreatic cancer apoptosis — and the direction is scientifically interesting. However, the study has significant methodological and interpretive gaps that must be addressed before ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Al-Sallami D. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 2; peer review: 2 approved, 2 approved with reservations]. F1000Research 2026, 15:68 (https://doi.org/10.5256/f1000research.197739.r471178)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
10
Cite
Reviewer Report 17 Apr 2026
Ramina Khoshaba Elia, University of Baghdad, Baghdad, Baghdad Governorate, Iraq 
Approved
VIEWS 10
Dr. Al-Fardan addresses an important and emerging topic in cancer biology, particularly the role of non-coding RNAs in apoptosis with clear biological focus on intrinsic apoptosis pathway. The study explores the role of SNORA64, a small nucleolar RNA, in regulating apoptosis-related genes in ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Elia RK. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 2; peer review: 2 approved, 2 approved with reservations]. F1000Research 2026, 15:68 (https://doi.org/10.5256/f1000research.197739.r471177)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
14
Cite
Reviewer Report 10 Apr 2026
Tingbo Liang, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China 
Approved
VIEWS 14
The authors have responded appropriately to the issues raised, ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Liang T. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 2; peer review: 2 approved, 2 approved with reservations]. F1000Research 2026, 15:68 (https://doi.org/10.5256/f1000research.197739.r470979)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 16 Jan 2026
Views
20
Cite
Reviewer Report 23 Feb 2026
Tingbo Liang, Zhejiang University School of Medicine, Hangzhou, Zhejiang, China 
Not Approved
VIEWS 20
Alfardan examines SNORA64 knockdown in PK-8 pancreatic adenocarcinoma cells using qPCR of BCL-2 family genes and viability/proliferation assays to argue SNORA64 regulates intrinsic apoptosis. While the concept is interesting, the conclusions are based mainly on mRNA changes and non-specific ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Liang T. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 2; peer review: 2 approved, 2 approved with reservations]. F1000Research 2026, 15:68 (https://doi.org/10.5256/f1000research.191586.r455858)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 26 Mar 2026
    Rana Alfardan, Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq
    26 Mar 2026
    Author Response
    Dear Dr. Tingbo Liang,

    Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 26 Mar 2026
    Rana Alfardan, Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq
    26 Mar 2026
    Author Response
    Dear Dr. Tingbo Liang,

    Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised ... Continue reading
Views
35
Cite
Reviewer Report 21 Jan 2026
Adeolu Oluremi, University of Arkansas at Little Rock, Little Rock, Arkansas, USA 
Approved with Reservations
VIEWS 35
Title & Abstract

Title: Consider making it more specific and impactful.
Suggestion: "Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network"

Abstract
Methods: The methods description is overly ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Oluremi A. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 2; peer review: 2 approved, 2 approved with reservations]. F1000Research 2026, 15:68 (https://doi.org/10.5256/f1000research.191586.r451315)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 26 Mar 2026
    Rana Alfardan, Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq
    26 Mar 2026
    Author Response
    Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro)

    Dear Dr. Adeolu Oluremi,
    Thank you very ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 26 Mar 2026
    Rana Alfardan, Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq
    26 Mar 2026
    Author Response
    Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro)

    Dear Dr. Adeolu Oluremi,
    Thank you very ... Continue reading

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 16 Jan 2026
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.