ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Article
Revised

Molecular signature of anastasis for reversal of apoptosis

[version 2; peer review: 3 approved]
PUBLISHED 09 Feb 2017
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

Anastasis (Greek for "rising to life") is a cell recovery phenomenon that rescues dying cells from the brink of cell death. We recently discovered anastasis to occur after the execution-stage of apoptosis in vitro and in vivo. Promoting anastasis could in principle preserve injured cells that are difficult to replace, such as cardiomyocytes and neurons. Conversely, arresting anastasis in dying cancer cells after cancer therapies could improve treatment efficacy. To develop new therapies that promote or inhibit anastasis, it is essential to identify the key regulators and mediators of anastasis – the therapeutic targets. Therefore, we performed time-course microarray analysis to explore the molecular mechanisms of anastasis during reversal of ethanol-induced apoptosis in mouse primary liver cells. We found striking changes in transcription of genes involved in multiple pathways, including early activation of pro-cell survival, anti-oxidation, cell cycle arrest, histone modification, DNA-damage and stress-inducible responses, and at delayed times, angiogenesis and cell migration. Validation with RT-PCR confirmed similar changes in the human liver cancer cell line, HepG2, during anastasis. Here, we present the time-course whole-genome gene expression dataset revealing gene expression profiles during the reversal of apoptosis. This dataset provides important insights into the physiological, pathological, and therapeutic implications of anastasis.

Keywords

Anastasis, apoptosis, Cell Death, Cell Survival, Gene Expression, Recovery, Repair, Reversal of Apoptosis

Revised Amendments from Version 1

In the revised manuscript, we have added new data that support our conclusions. Specifically, our RT-PCR reveals that a human liver cancer cell line displays similar gene expression profile during anastasis as observed in mouse primary liver cells. Additional microarray statistical analysis is included as supplementary data. We have also discussed the potential molecular mechanisms, physiological and pathological consequences, and therapeutic potentials of anastasis.

See the authors' detailed response to the review by Takafumi Miyamoto

Introduction

Apoptosis (Greek for “falling to death”) is essential for normal development and homeostasis of multicellular organisms by eliminating unwanted, injured, or dangerous cells13. This cell suicide process was generally assumed to be irreversible because it involves rapid and massive cell destruction49. During apoptosis, intrinsic and extrinsic pro-apoptotic signals can converge at mitochondria, leading to mitochondrial outer membrane permeabilization (MOMP), which releases cell execution factors, such as cytochrome c to trigger activation of apoptotic proteases including caspase-3 and -710,11, small mitochondria-derived activator of caspases (Smac)/direct IAP binding protein with low pI (DIABLO) to eliminate inhibitor of apoptosis protein (IAP) which suppresses caspase activation12,13, and apoptosis-inducing factor (AIF) and endonuclease G to destroy DNA1417. Activated caspases commit cells to destruction by cleaving hundreds of functional and structural cellular substrates4,18. Crosstalk between signalling pathways amplifies the caspase cascade to mediate cell demolition via nucleases (DNA fragmentation factor [DFF]/caspase-activated DNase [CAD]) to further destroy the genome1921, and alter lipid modifying enzymes to cause membrane blebbing and apoptotic body formation22,23. Therefore, cell death is considered to occur after caspase activation within a few minutes2426.

However, we and other groups have demonstrated reversal of early stage apoptosis, such as externalization of phosphatidylserine (PS) in cultured primary cells and cancer cell lines2730. We have further demonstrated that dying cells can reverse apoptosis even after reaching the generally assumed “point of no return”2931, such as MOMP-mediated cytochrome c release, caspase-3 activation, DNA damage, nuclear fragmentation, and apoptotic body formation49. Our observation of apoptosis reversal at late stages is further supported by an independent study, which shows recovery of cells after MOMP32. To detect reversal of apoptosis in live animals, we have further developed a new in vivo caspase biosensor, designated “CaspaseTracker”33, to identify and track somatic, germ and stem cells that recover after transient cell death inductions, and also potentially during normal development and homeostasis in Drosophila melanogaster after caspase activation33,34, the hallmark of apoptosis4,35. We proposed the term “anastasis”30, which means “rising to life” in Greek, to describe this recovery from the brink of cell death. Anastasis appears to be an intrinsic cell survival phenomenon, as removal of cell death stimuli is sufficient to allow dying cells to recover2931,33.

The physiological, pathological and therapeutic importance of anastasis is not yet known. We proposed that anastasis could be an unexpected tactic that cancer cells use to escape cancer therapy2931. Many tumours undergo dramatic initial responses to cell death-inducing radiation or chemotherapy3639; however, these cells relapse, and metastasis often occurs in most types of cancer3639. Therefore, the ability of cells to recover from transient induction of cell death may allow tumour cells to escape treatment, and survive and proliferate, resulting in relapse2931. Furthermore, cells may acquire new oncogenic mutations and transformation phenotypes during anastasis30,31, such as DNA damage caused by apoptotic nucleases. Therefore, anastasis could be one of the mechanisms underlying the observation that repeated tissue injury increases the risk of cancer in a variety of tissues40, such as liver damage due to alcoholism41, chronic thermal injury in the oesophagus induced by the consumption of very hot beverages4244, evolution of drug resistance in recurrent cancers3639,45, and development of a second cancer during subsequent therapy4649. Anastasis can also occur in primary cardiac cells and neuronal cell lines30,31, and potentially in cardiomyocytes in vivo following transient ischemia50. These findings suggest anastasis as an unexpected cellular protective mechanism. Therefore, uncovering the mechanisms of anastasis may provide new insights into the regulation of cell death and survival, and harnessing this mechanism via suppression or promotion of anastasis would aid treatment of intractable diseases including cancer, heart failure and neurodegeneration.

Our previous study demonstrated reversibility of ethanol-induced apoptosis at late stages in mouse primary liver cells, and revealed that new transcription is important to reverse apoptosis30,31. During recovery, we found up-regulation of genes involved in pro-survival pathways and DNA damage responses during anastasis (Bag3, Mcl1, Dnajb1, Dnajb9, Hsp90aa1, Hspa1b, and Hspb1, Mdm2)30. Interestingly, inhibiting some of those genes by corresponding specific chemical inhibitors significantly suppresses anastasis30. However, the molecular mechanism of anastasis remains to be elucidated. To study the cellular processes of anastasis, we performed time-course RNA microarray analysis to determine the gene expression profiles of the cultured mouse primary liver cells undergoing anastasis following transient exposure to ethanol that triggers apoptosis, and identified unique gene expression patterns during reversal of apoptosis. We also performed reverse transcription polymerase chain reaction (RT-PCR) to validate the gene expression patterns in the human liver cancer cell line, HepG2, during anastasis. Here, we present our time-course microarray data, which reveals the molecular signature of anastasis.

Methods

Microarray

Mouse primary liver cells were isolated from BALB/c mice using collagenase B and cultured as described30,51. The cells were cultured in in DMEM/F-12 (DMEM:nutrient mixture F-12) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin (Life Technologies, Carlsbad, CA, USA) at 37°C under an atmosphere of 5% CO2/95% air. To induce apoptosis, cells were exposed to 4.5% ethanol for 5 hours (R0) in the culture medium (vol/vol). To allow recovery, dying cells were washed and further incubated in the fresh culture medium for 3 hours (R3), 6 hours (R6), 24 hours (R24), and 48 hours (R48). The untreated cells served as control (Ctrl). Three biological replicates were performed at each time point. Total RNA in the corresponding cell conditions was harvested using TRIzol Reagent (Life Technologies). The RNA was purified using the RNeasy Mini Kit (Qiagen, Cologne, Germany). Reverse transcription was performed using SABiosciences C-03 RT2 First Strand Kit to construct cDNA (SABiosciences-Qiagen, Frederick, MD, USA). The cDNA samples were analysed using the Illumina MouseWG-6 v2.0 Expression BeadChip (Illumina, San Diego, CA, USA).

Gene expression data analysis

The Partek Genomics Suite 6.6 (Partek, St. Louis, MO, USA) was used for principal component analysis (PCA)52,53. The Spotfire DecisionSite 9.1.2 (TIBCO, Palo Alto, CA, USA) platform was used to evaluate the fold change of gene expression levels between time points when compared with a common starting point, which is the control (Ctrl)54. Signal values were converted into log2 space and quality control tests were performed to ensure data integrity by comparing the signals of the three biological replicates at each time point. The fold change was based on averaged values of the three replicates at each time point; two-sample Student's t-test was used to determine statistical significance as p-values of less than 0.05, using the Partek Genomics Suite v6.5 (Partek Inc., St. Louis, MO, USA).

For the time-course gene expression analysis using Spotfire, all time points were compared with the time point Ctrl, which represents untreated cells. Spotfire was used to show the genes that displayed specific changes in gene expression after removal of cell death inducer for 3 hours (R3) and 6 hours (R6). Genes with specific and significant change (Log2 > 1 or <-1) in expression at the corresponding timepoint are highlighted. Interaction network analysis of the up-regulated genes during anastasis was performed using the GeneMANIA database (http://genemania.org/)55,56.

Confocal microscopy

Cells were incubated with 50 nM Mitotracker Red CMXRos and 250 ng/ml Hoechst 33342 (Invitrogen) for 20 minutes in culture medium to stain mitochondria and nuclei, respectively. The stained cells were washed and incubated with culture medium for 10 minutes, and then were fixed with 3.7% (wt/vol) paraformaldehyde in phosphate-buffer saline (PBS) solution for 20 minutes at room temperature in dark. The fixed cells were mounted on glass slide using ProLong Diamond Antifade Mountant (Invitrogen). Cell images were captured with the Zeiss LSM 780 confocal inverted microscope using a 40×, numerical aperture (NA) 1.4 plan-Apochromat objective (Carl Zeiss, Jena, Germany), and were analyzed using Zen 2013 or AxioVision 4.2 software (Carl Zeiss).

Reverse transcription polymerase chain reaction (RT-PCR)

Human liver cancer cell line HepG2 (ATCC HB-8065) was cultured in DMEM/F-12, 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin (Life Technologies) at 37°C under an atmosphere of 5% CO2/95% air. Apoptosis was induced by incubation of the cells with 4.5% ethanol in cell culture medium for 5 hours (R0). Then, the apoptotic dying cells were washed and then incubated in the fresh culture medium for 1 hour (R1), 2 hours (R2), 3 hours (R3), 4 hours (R4), 6 hours (R6), 9 hours (R9), 12 hours (R12), and 24 hours (R24). The untreated cells served as control (Ctrl). Total RNA in the corresponding cell conditions was harvested using QIAzol lysis reagent (Qiagen). The total RNA was purified using the RNeasy Mini Kit (Qiagen). Reverse transcription was performed using the SuperScript IV reverse transcriptase system (Thermo Fisher Scientific, Waltham, MA, USA). Primer sets for detecting targeted genes were designed using the Universal ProbeLibrary (Roche Applied Science, Madison, WI). Primer set for MMP10 was previously designed57. Polymerase Chain Reaction (PCR) was performed using Taq DNA Polymerase and PCR protocol (New England BioLabs, Ipswich, MA, USA), with initial denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 3 seconds. Electrophoresis of PCR products was performed using 4% agarose gel.

Results and discussion

We have demonstrated that mouse primary liver cells can reverse the apoptotic process at the execution stage30,31, despite reaching important checkpoints commonly believed to be the “point of no return”49, including caspase-3 activation, DNA damage, and cell shrinkage. To pursue the mechanisms of anastasis, we performed time-course high-throughput microarray to evaluate gene expression profiles during reversal of ethanol-induced apoptosis in mouse primary liver cells. RNA samples were collected from the untreated primary liver cells (Ctrl), the cells treated with 4.5% ethanol for 5 hours when cells exhibited hallmarks of apoptosis (R0), and the treated cells that were then washed and cultured in fresh medium for 3 (R3), 6 (R6), 24 (R24) and 48 (R48) hours. Apoptosis was confirmed in the ethanol-treated cells (R0), which displayed hallmarks of apoptosis, including plasma membrane blebbing, cell shrinkage, cleavage of caspase-3 and its substrates, such as PARP and ICAD (Figure 1A and B, images reprinted with permission30). The features of apoptosis vanished after removal of the cell death inducer (R24), indicating recovery of the cells (Figure 1A and B). Three biological replicates were performed at each time point. The principal component analysis indicated that all three biological replicates of each time point exhibited a very high correlation, as indicated by clustering, for the dataset of all 18 samples (Figure 2A; Supplementary Figure 1; see Data availability). The unsupervised hierarchical clustering confirms the similarity between all the replicates at each time point (Figure 2B; see Data availability; Supplementary Figure 2).

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure1.gif

Figure 1. Flow chart for experimental design.

Mouse primary liver cells were treated with 4.5% ethanol for 5 hours (R0) and then washed and cultured in fresh medium for 3 (R3), 6 (R6), 24 (R24), and 48 (R48) hours. The untreated cells served as control (Ctrl). (A) Time-lapse live-cell light microscopy and (B) Western blot analysis validated apoptosis to occur at R0, and anastasis at R24. Cells were collected at the indicated timepoints of (A) for RNA extraction. Gene expression profiling was performed by microarray, and analysed by Spotfire. The images from Figure 1A and B are adopted from the Mol Biol Cell 23, 2240–52 (2012)30. Reprinted with permission.

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure2.gif

Figure 2. Technical validation of microarray data.

The three biological replicate samples of microarray data were shown to cluster together by using (A) principal component analysis (PCA) and (B) unsupervised hierarchical clustering of the RNA microarray data of eighteen samples.

Genes that display significant changes in expression during anastasis at the earliest time point of 3 hours, following the removal of the cell death inducer, may represent critical first responders of anastasis (Figure 3A, Table 1), including transcription factors of the activator protein-1 (AP-1) family (Atf3, Fos, Fosb, Jun, Junb), transforming growth factor-β (TGF-β) signal pathway and its related regulators (Inhba, Snai1, Tgif1, Sox4, Sox9, Klf4, Klf6, Klf9), pro-survival Bcl-2 family member (Bag3), inhibitor of p53 (Mdm2), anti-oxidation (Hmox1), anti-proliferation (Btg1), DNA damage (Ddit3, Ddit4), vesicular trafficking (Vps37b) and stress-inducible (Dnajb1, Dnajb9, Herpud1, Hspb1, Hspa1b) responses. Starting at 6 hours of anastasis, other groups of gene pathways display the peak of transcription, such as cell cycle arrest (Cdkn1a, Trp53inp1), autophagy (Atg12, Sqstm1), and cell migration (Mmp9, Mmp10 and Mmp13) (Figure 3B, Table 1 and Table 2). Expression of potent angiogenic factors, such as Vegfa and Angptl4, are up-regulated at 3 and 6 hours of anastasis, respectively (Table 1 and Table 2). Histones display up- (Hist1h2ae, H2afj) and down- (Hist1h2ak, Hist1h2ag, Hist1h2ap, Hist1h2af, Hist2h2ac, Hist1h2ah) regulations during the first 6 hours of anastasis (Table 2 and Table 3). Changes in expression of most of these genes peak at the 3–6-hour time points after removal of the apoptotic stimulus and then return to baseline (Figure 3A and B; Supplementary Figure 2). Interestingly, certain genes such as splicing of pre-mRNA (Rnu6), and growth arrest and DNA repair (Gadd45g) stay up-regulated during both apoptosis and anastasis (Figure 3C, Table 4).

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure3.gif

Figure 3. Change of gene expression profiles during reversal of apoptosis in mouse primary liver cells.

Log2-fold change of gene expression comparison between untreated cells (Ctrl), ethanol-induced apoptotic cells (R0), and induced cells that were then washed and further cultured in fresh medium for 3 (R3), 6 (R6), 24 (R24), and 48 (R48) hours. Genes that displayed specific (A) up-regulation at R3, (B) up- or down-regulation at R6, and (C) up-regulation anytime during the period from R0 to R6 with absolute log2 fold change >1 are highlighted. The log2 signal values from three biological replicates were averaged (geometric mean) for each time point.

Table 1. List of top 67 up-regulated genes at 3rd hour (R3) of anastasis, with log2 fold change >1, compared with Ctrl (untreated cells).

Sort
Order
Gene SymbolDefinitionAccessionLog2 fold
change
R3 vs. Ctrl
1Atf3activating transcription factor 3NM_007498.24.08867
2Hspa1bheat shock protein 1BNM_010478.23.88264
3FosbFBJ osteosarcoma oncogene BNM_008036.23.40725
4FosFBJ osteosarcoma oncogeneNM_010234.23.03649
5Egr2no definitionNM_010118.12.82862
6Dnajb1DnaJ (Hsp40) homolog, subfamily B, member 1NM_018808.12.78017
7Dusp1dual specificity phosphatase 1NM_013642.22.533
8Sox9SRY-box containing gene 9NM_011448.22.37421
9Zfp36zinc finger protein 36NM_011756.42.33651
10Mfsd11no definitionAK0078982.31434
11Hspb1no definitionNM_0135602.30989
12JunJun oncogeneNM_010591.12.28214
13Ddit4DNA-damage-inducible transcript 4NM_029083.12.25327
14Vegfavascular endothelial growth factor A (Vegfa), transcript
variant 1
NM_001025250.22.19637
15Herpud1homocysteine-inducible, ER stress-inducible,
ubiquitin-like domain member 1
NM_022331.12.17913
16Ddit3DNA-damage inducible transcript 3NM_007837.22.16334
17Mdm2transformed mouse 3T3 cell double minute 2NM_010786.32.11273
18Chac1ChaC, cation transport regulator-like 1NM_026929.32.08317
19Arcactivity regulated cytoskeletal-associated proteinNM_018790.21.99046
20Dnajb9DnaJ (Hsp40) homolog, subfamily B, member 9NM_013760.41.961
21Zfand2azinc finger, AN1-type domain 2ANM_133349.21.8778
22Hes1hairy and enhancer of split 1NM_008235.21.85536
23Bag3BCL2-associated athanogene 3NM_013863.41.85303
24LOC100048331PREDICTED: similar to DnaJ (Hsp40) homolog,
subfamily A, member 4
XR_034509.11.82115
25Hmox1heme oxygenaseNM_010442.11.82111
26Hspa5heat shock protein 5NM_022310.21.8205
27Dlx2distal-less homeobox 2NM_010054.11.62035
286430590I03Rikno definitionXM_4895351.61804
29JunbJun-B oncogene (Junb)NM_008416.11.61245
30LOC381140no definitionXM_355056.11.57312
315430411C19RikPREDICTED: RIKEN cDNA 5430411C19 geneXM_001478639.11.56805
32Hspa1ano definitionNM_0104791.56028
33Csrnp1AXIN1 up-regulated 1NM_153287.31.46632
34Tnfaip3tumor necrosis factor, alpha-induced protein 3NM_009397.21.45772
35LOC100048105PREDICTED: similar to Ubc protein, transcript variant 1XM_001479832.11.45617
36Bhlhe40basic helix-loop-helix domain containing, class B2NM_011498.41.39137
37Dyrk3dual-specificity tyrosine-(Y)-phosphorylation regulated
kinase 3
NM_145508.21.3612
38Egr1early growth response 1NM_007913.51.35873
39Klf9PREDICTED: RIKEN cDNA 2310051E17 geneXM_001479552.11.35306
40Snai1snail homolog 1NM_011427.21.35105
41Dusp2dual specificity phosphatase 2NM_010090.21.34955
42Ubgno definitionno accession1.3258
43BC022687cDNA sequence BC022687NM_145450.31.31366
44Btg1B-cell translocation gene 1, anti-proliferativeNM_007569.11.2996
45LOC100046232PREDICTED: similar to NFIL3/E4BP4 transcription
factor
XM_001475817.11.27509
46Hsph1no definitionNM_013559.11.2662
47Hist1h2aehistone cluster 1, H2aeNM_178187.31.26359
48mtDNA_ND4Lno definitionno accession1.2474
49Dnajb4DnaJ (Hsp40) homolog, subfamily B, member 4NM_025926.11.24227
50Klf4Kruppel-like factor 4NM_010637.11.23324
51Tgif1TGFB-induced factor homeobox 1NM_009372.21.22645
52Klf6Kruppel-like factor 6NM_011803.21.22027
53Ppp1r10protein phosphatase 1, regulatory subunit 10NM_175934.21.21047
54Gm16516no definitionNM_025293.11.20916
55Ifrd1interferon-related developmental regulator 1NM_013562.11.19232
56Slc23a3solute carrier family 23 (nucleobase transporters),
member 3
NM_194333.31.18765
57Mfsd11major facilitator superfamily domain containing 11NM_178620.31.16606
58Gm4589PREDICTED: hypothetical protein LOC100045678XM_001475512.11.16498
59Klf9Kruppel-like factor 9NM_010638.41.12553
60Siah2seven in absentia 2NM_009174.31.11181
61Map1lc3bmicrotubule-associated protein 1 light chain 3 betaNM_026160.31.10454
62Plk2polo-like kinase 2NM_152804.11.05963
63Fgf21fibroblast growth factor 21NM_020013.41.05538
64Id4inhibitor of DNA binding 4NM_031166.21.04488
65Csf1colony stimulating factor 1NM_007778.31.03533
66Bbc3BCL2 binding component 3 (Bbc3)NM_133234.11.03288
676230400G14Rikno definitionno accession1.02327

Table 2. List of top 109 up-regulated genes at 6th hour (R6) of anastasis, with log2 fold change >0.93, compared with Ctrl (untreated cells).

Sort
Order
Gene SymbolDefinitionAccessionLog2 fold
change
R6 vs. Ctrl
1Inhbainhibin beta-ANM_008380.13.86584
2Mmp10matrix metallopeptidase 10NM_019471.23.39644
3Lce1flate cornified envelope 1FNM_026394.22.99957
4Serpinb2serine (or cysteine) peptidase inhibitor, clade B,
member 2
NM_011111.32.77022
5Serpina3hserine (or cysteine) peptidase inhibitor, clade A,
member 3H
NM_001034870.22.65107
6Mmp13matrix metallopeptidase 13NM_008607.12.62637
7Ptpn22protein tyrosine phosphatase, non-receptor type 22NM_008979.12.45292
8Rgs16regulator of G-protein signaling 16NM_011267.22.18647
9Nppbnatriuretic peptide precursor type BNM_008726.32.15071
10Has1hyaluronan synthase1NM_008215.12.14235
11Dusp5no definitionXM_140740.32.09536
12Sqstm1sequestosome 1NM_011018.22.07477
13Nupr1nuclear protein 1NM_019738.12.06313
14Sphk1sphingosine kinase 1 (Sphk1), transcript variant 2NM_025367.51.94856
15Dusp4dual specificity phosphatase 4NM_176933.41.85742
16Klhl21kelch-like 21NM_001033352.31.84531
17LorloricrinNM_008508.21.81763
18Ndrg1N-myc downstream regulated gene 1NM_008681.21.79158
19Srxn1sulfiredoxin 1 homologNM_029688.41.78335
20Hk2PREDICTED: hypothetical protein LOC100047934XM_001478074.11.7519
21Txnrd1thioredoxin reductase 1 (Txnrd1), transcript variant 1NM_001042523.11.75148
22Angptl4no definitionNM_0205811.72982
23Trib3tribbles homolog 3NM_175093.21.72246
24C330006P03Rikno definitionno accession1.71297
25Cdkn1acyclin-dependent kinase inhibitor 1ANM_007669.21.69118
26Gdf15growth differentiation factor 15NM_011819.11.67887
27Prkg2protein kinase, cGMP-dependent, type IINM_008926.31.67374
28H2afjH2A histone family, member JNM_177688.21.64825
29Hbegfheparin-binding EGF-like growth factorNM_010415.11.61893
30Trp53inp1transformation related protein 53 inducible nuclear
protein 1
NM_021897.11.61348
31Gfpt2glutamine fructose-6-phosphate transaminase 2NM_013529.21.58159
32Slc7a11no definitionAK0374901.57761
33Ndrg1no definitionNM_0086811.5652
34Gprc5aG protein-coupled receptor, family C, group 5, member ANM_181444.31.51339
35Ibrdc3no definitionXM_2040301.49816
36Ngfnerve growth factor, betaNM_013609.11.48619
37Lce1dlate cornified envelope 1DNM_027137.21.44977
38Tpsab1tryptase alpha/beta 1NM_031187.21.44267
39Htr2b5-hydroxytryptamine (serotonin) receptor 2BNM_008311.21.43265
40Sox4SRY-box containing gene 4NM_009238.21.41763
41Il1rl1interleukin 1 receptor-like 1 (Il1rl1), transcript variant 1NM_001025602.11.3994
42Prr9RIKEN cDNA A030004J04 gene (A030004J04Rik)NM_175424.31.36416
43VgfVGF nerve growth factor inducibleNM_001039385.11.35246
44Errfi1ERBB receptor feedback inhibitor 1NM_133753.11.34582
45Il6interleukin 6NM_031168.11.33283
46Gprc5ano definitionNM_1814441.31955
47Antxr2anthrax toxin receptor 2NM_133738.11.30719
48Tgif1TGFB-induced factor homeobox 1NM_009372.21.29814
49Krt8keratin 8NM_031170.21.28819
502300009A05RikPREDICTED: RIKEN cDNA 2300009A05 gene,
transcript variant 3
XM_898537.21.26684
51Dppa5adevelopmental pluripotency associated 5NM_025274.11.258
52Mt2metallothionein 2NM_008630.21.2441
53Plaurplasminogen activator, urokinase receptorNM_011113.31.22553
54ThbdthrombomodulinNM_009378.21.22252
55LOC100047353PREDICTED: similar to myocardial vascular inhibition
factor
XM_001477963.11.22053
56Csf2colony stimulating factor 2 (granulocyte-macrophage)NM_009969.41.22019
57Map2k1mitogen-activated protein kinase kinase 1NM_008927.31.21788
58Dpp7dipeptidylpeptidase 7NM_031843.21.21624
59LOC672274PREDICTED: similar to Transcription factor SOX-4XR_003788.11.21149
60Blcapbladder cancer associated protein homologNM_016916.31.21046
61Zfc3h1no definitionNM_001033261.21.20585
62Dusp6dual specificity phosphatase 6NM_026268.11.20441
63AregamphiregulinNM_009704.31.19656
64C630022N07Rikno definitionno accession1.19569
65Denrdensity-regulated proteinNM_026603.11.18464
66Slc3a2solute carrier family 3 (activators of dibasic and neutral
amino acid transport), member 2
NM_008577.31.18244
67Ern1endoplasmic reticulum (ER) to nucleus signalling 1NM_023913.21.15145
68Dnmt3lDNA (cytosine-5-)-methyltransferase 3-like (Dnmt3l),
transcript variant 2
NM_001081695.11.13992
69D130007C19Rikno definitionAK0511521.13724
70LOC100046401PREDICTED: similar to SDR2XR_032583.11.1332
71Sh3bp2SH3-domain binding protein 2NM_011893.21.11999
72Tgoln1trans-golgi network proteinNM_009443.31.11454
73Gm12226similar to oxidative stress responsive 1 (Rp23-297j14.5)NM_001099322.11.11231
74Stk40no definitionNM_0288001.11149
75Marcksl1MARCKS-like 1 (Marcksl1), mRNA.NM_010807.31.09791
76Ypel5yippee-like 5 (Drosophila) (Ypel5), mRNA.NM_027166.31.08882
77Fam180aNo definitionNM_1733751.08779
78Creb3l2cAMP responsive element binding protein 3-like 2
(Creb3l2), mRNA.
NM_178661.31.08689
79Ly96lymphocyte antigen 96 (Ly96), mRNA.NM_016923.11.06285
80Igf2bp2insulin-like growth factor 2 mRNA binding protein 2
(Igf2bp2), mRNA.
NM_183029.11.06145
81Mafgv-maf musculoaponeurotic fibrosarcoma oncogene
family, protein G
NM_010756.31.05594
82Cttnbp2nlNo definitionNM_0302491.04697
83Col20a1PREDICTED: collagen, type XX, alpha 1 (Col20a1),
mRNA.
XM_181390.51.04143
84Vps37bvacuolar protein sorting 37B (yeast) (Vps37b), mRNA.NM_177876.41.03812
85A530046M15No definitionXM_4886631.03773
86Eid3EP300 interacting inhibitor of differentiation 3 (Eid3),
mRNA.
NM_025499.21.03567
87Nabp1oligonucleotide/oligosaccharide-binding fold containing
2A (Obfc2a), mRNA.
NM_028696.21.0351
88Pqlc1PQ loop repeat containing 1 (Pqlc1), mRNA.NM_025861.21.03363
89Whrnwhirlin (Whrn), transcript variant 6, mRNA.NM_001008795.11.0255
90Cishcytokine inducible SH2-containing protein (Cish),
mRNA.
NM_009895.31.02328
91Ptpreprotein tyrosine phosphatase, receptor type, E (Ptpre),
mRNA.
NM_011212.21.01915
92Bach1BTB and CNC homology 1 (Bach1), mRNA.NM_007520.21.01808
93Cyb5r1cytochrome b5 reductase 1 (Cyb5r1), mRNA.NM_028057.21.01401
94Slc1a4solute carrier family 1 (glutamate/neutral amino acid
transporter), member 4
NM_018861.21.00471
95Mmdno definitionAK0338890.998067
96Slc6a9solute carrier family 6 (neurotransmitter transporter,
glycine), member 9
NM_008135.40.994683
97LOC100047963PREDICTED: similar to ADIR1XM_001479238.10.994667
98Atf4activating transcription factor 4NM_009716.20.982833
99Cttnbp2nlCTTNBP2 N-terminal likeNM_030249.30.970113
100Mmp9matrix metallopeptidase 9NM_013599.20.968853
101Hmga1high mobility group AT-hook 1NM_016660.20.96846
102Phlda1pleckstrin homology-like domain, family A, member 1NM_009344.10.963867
103Aarsalanyl-tRNA synthetaseNM_146217.30.962397
104Angpt2angiopoietin 2NM_007426.30.95926
105Zswim4zinc finger, SWIM domain containing 4NM_172503.30.957373
106Selkno definitionNM_019979.10.954917
107Abhd2abhydrolase domain containing 2NM_018811.60.954587
108Krtap4-16predicted gene, OTTMUSG00000002196NM_001013823.10.95438
109Atg12autophagy-related 12NM_026217.10.94998

Table 3. List of top 50 down-regulated genes at 6th hour (R6) of anastasis, with log2 fold change <-0.95, compared with Ctrl (untreated cells).

Sort
Order
Gene SymbolDefinitionAccessionLog2 fold
change
R6 vs. Ctrl
1Hist1h2akhistone cluster 1, H2akNM_178183.1-1.91761
2Hist1h2aghistone cluster 1, H2agNM_178186.2-1.76767
3Hist1h2aphistone cluster 1, H2aoNM_178185.1-1.7396
4Hist1h2afhistone cluster 1, H2afNM_175661.1-1.6854
5Hist2h2achistone cluster 2, H2acNM_175662.1-1.6272
6Slc1a3solute carrier family 1 (glial high affinity glutamate
transporter), member 3
NM_148938.2-1.61827
79930013L23Rikno definitionAK018112-1.59264
8Hist1h2ahhistone cluster 1, H2ahNM_175659.1-1.57002
9Hist1h2alPREDICTED: predicted gene, EG667728XR_035278.1-1.56907
10Hist1h2adhistone cluster 1, H2adNM_178188.3-1.56233
11ScelsciellinNM_022886.2-1.48845
12Hist1h2aihistone cluster 1, H2aiNM_178182.1-1.40187
13Fzd2frizzled homolog 2NM_020510.2-1.38203
14Sdprserum deprivation responseNM_138741.1-1.38033
15Hs3st1heparan sulfate (glucosamine) 3-O-sulfotransferase 1NM_010474.1-1.32418
16Hist2h2abhistone cluster 2, H2abNM_178213.3-1.30977
17Kif2ckinesin family member 2C (Kif2c) XM_986361NM_134471.3-1.21821
18Fam198bRIKEN cDNA 1110032E23 gene (1110032E23Rik)NM_133187.2-1.1988
19Cdc42ep2CDC42 effector protein (Rho GTPase binding) 2NM_026772.1-1.19681
20Lurap1lDNA segment, Chr 4, Brigham & Women's Genetics 0951
expressed (D4Bwg0951e)
NM_026821.4-1.18656
21MedagRIKEN cDNA 6330406I15 geneNM_027519.1-1.18243
22Disp1dispatched homolog 1NM_026866.2-1.18107
23Bmp4bone morphogenetic protein 4NM_007554.2-1.16637
24Rab27aRAB27A, member RAS oncogene familyNM_023635.4-1.13917
25Aurkaaurora kinase ANM_011497.3-1.12507
26Ncaphnon-SMC condensin I complex, subunit HNM_144818.1-1.12132
27Fignl1fidgetin-like 1NM_021891.2-1.10521
28DbpD site albumin promoter binding proteinNM_016974.1-1.09945
29Meis2Meis homeobox 2 (Meis2), transcript variant 2NM_010825.2-1.08487
30SynpoPREDICTED: synaptopodin, transcript variant 2XM_981156.1-1.08076
31Hist1h2anhistone cluster 1, H2anNM_178184.1-1.0804
32Fam111aRIKEN cDNA 4632417K18 gene (4632417K18Rik)NM_026640.2-1.07617
33Aurkbaurora kinase BNM_011496.1-1.07507
34Anlnanillin, actin binding proteinNM_028390.2-1.07218
35Tuft1tuftelin 1NM_011656.2-1.06969
36Cxcl12chemokine (C-X-C motif) ligand 12 (Cxcl12), transcript
variant 1
NM_021704.2-1.0664
37Sipa1l1signal-induced proliferation-associated 1 like 1NM_172579.1-1.03567
38Rbms2RNA binding motif, single stranded interacting protein 2NM_019711.2-1.03096
39Wdr6WD repeat domain 6NM_031392.2-1.02705
40Tk1thymidine kinase 1NM_009387.1-1.02669
41Mylkmyosin, light polypeptide kinaseNM_139300.3-1.01621
42Slc9a3r1solute carrier family 9 (sodium/hydrogen exchanger),
member 3 regulator 1
NM_012030.2-1.0137
43Kif22kinesin family member 22NM_145588.1-1.01346
44Speer3spermatogenesis associated glutamate (E)-rich protein 3NM_027650.2-1.01229
45MrgprfMAS-related GPR, member FNM_145379.2-1.01038
46Bub1bbudding uninhibited by benzimidazoles 1 homolog, betaNM_009773.1-1.00547
47Pcgf5polycomb group ring finger 5NM_029508.3-1.00513
48Marcksmyristoylated alanine rich protein kinase C substrateNM_008538.2-0.973133
49Fam83d2310007D09RikNM_027975.1-0.966323
50Slc16a4solute carrier family 16 (monocarboxylic acid transporters),
member 4
NM_146136.1-0.96461

Table 4. List of top 15 up-regulated genes during apoptosis (R0) and anastasis (R3 and R6), with log2 fold change >1 either on R0, R3, or R6, compared with Ctrl (untreated cells).

Log2 fold change
Sort
Order
Gene SymbolDefinitionAccessionR0 vs. CtrlR3 vs. CtrlR6 vs. CtrlR24 vs. Ctrl
1Rnu6U6 small nuclear
RNA
NR_003027.12.751632.081171.632030.315967
2Med23no definitionAK0423462.537922.375551.870410.70258
3Prf1perforin 1NM_011073.22.409812.364441.13810.262567
4F830002E14Rikno definitionAK0895672.187870.5492070.731387‐0.08211
5Slc11a1solute carrier
family 11
(proton-coupled
divalent metal
ion transporters),
member 1
NM_013612.11.518372.245471.503370.53101
6Hist1h4ahistone cluster
1, H4a
NM_178192.11.463521.199780.870870.08441
7Hist1h4jhistone cluster
1, H4j
NM_178210.11.42761.151980.8019330.241233
82310005L22Rikno definitionno accession1.192441.235740.793190.0878833
92810026P18Rikno definitionno accession1.123931.147430.527953‐0.31585
10Gadd45ggrowth arrest and
DNA-damage-
inducible 45
gamma
NM_011817.11.041771.850131.0444‐0.324567
11Sppl3no definitionAK0478861.012691.852841.222050.51878
121810026B05Rikno definitionXM_4891860.98920.924410.742947‐0.257843
13BC030476cDNA sequence
BC030476
NM_173421.10.983911.511160.4954470.2612
14Zbtb2zinc finger and
BTB domain
containing 2
NM_001033466.10.8824571.251710.253943‐0.116403
15Ppp1r15amyeloid
differentiation
primary response
gene 116
NM_008654.10.8629932.486961.82011‐0.25323

We further observed the similar changes in gene expressions during anastasis in cultured human liver cancer HepG2 cells (Figure 4; see Data availability). The untreated HepG2 cells displayed tubular and filamentous mitochondria in the cells that spread on the substrate (Figure 4Ai, 4B). After exposure to 4.5% ethanol for 5 hours, the treated cells displayed morphological hallmarks of apoptosis, such as mitochondrial fragmentation, nuclear condensation, plasma membrane blebbing, and cell shrinkage (Figure 4Aii, 4B). After washed and incubated with fresh culture medium, the treated cells regained normal morphology (Figure 4Aiii, 4B). Interestingly, the HepG2 cells that underwent anastasis displayed the increase in micronuclei formation (Figure 4B), which is the biomarker of DNA damage58, as we previously observed in mouse primary liver cells, mouse embryonic fibroblast NIH 3T3 cells, human cervical cancer HeLa cells, and human small cell lung carcinoma H446 cells30,31. By using reverse transcription polymerase chain reaction (RT-PCR), we verified our microarray data on HepG2 cells during reversal of ethanol-induced apoptosis, and found similar gene expression patterns during anastasis, including changes in mRNA levels of ANGPTL4, ATF3, ATG12, CDKN1A, FOS, HSPA1B, JUN, MDM2, MMP10 and SOX9 (Figure 4C; Supplementary Figure 3). This suggests that the mechanism of anastasis is conserved between primary and cancer cells.

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure4.gif

Figure 4. Change of gene expressions during reversal of apoptosis in human liver cancer HepG2 cells.

(A) Confocal and differential interference contrast (DIC) microscopy of untreated liver cells (i Untreated), cells that were exposed to 4.5% ethanol for 5 hours (ii Treated), and the treated cells that were washed to remove apoptosis inducer and further cultured for 6 hours (iii Washed). Merged images, mitochondria (red) and nuclei (blue) were visualized by confocal microscopy and cell morphology by DIC. Monochrome images, nucleus of the corresponding cells. Scale bar, 10 μm. (B) Quantification of the apoptotic response and its reversal on HepG2 cells. Percentage of the untreated cells, the treated cells (4.5% ethanol, 5 hours) and the washed cells (24 hours) showing mitochondrial fragmentation, nuclear condensation, cell shrinkage, and formation of micronuclei. (C) RT-PCR gel analysis of changes in mRNA levels of ANGPTL4, ATF3, ATG12, CDKN1A, FOS, GUSB, HSPA1B, JUN, MDM2, MMP10 and SOX9 on the untreated (Ctrl), the treated (R0, 4.5% ethanol for 5 hours), and the treated cells that were then washed and incubated in fresh medium for 1 hour (R1), 2 hours (R2), 3 hours (R3), 4 hours (R4), 6 hours (R6), 9 hours (R9), 12 hours (R12), and 24 hours (R24). GUSB serves as housekeeping gene. Sequences of primer sets for detecting targeted genes are available in Table 5.

Table 5. List of primer sequences for RT-PCR.

GeneAccession numberForward primerReverse primerAmplicon
ANGPTL4NM_139314.2gacaagaactgcgccaagagccgttgaggttggaatg72
ATF3NM_001674.3cgtgagtcctcggtgctcgcctgggtgttgaagcat112
ATG12NM_004707.3tcttccgctgcagtttccgtctcccacagcctttagca87
CDKN1ANM_000389.4tgggtggtaccctctggatgaatttcataaccgcctgtg65
FOSNM_005252ctggcgttgtgaagaccatccttttctcttcttcttctggagat95
GUSBNM_000181.3cgccctgcctatctgtattctccccacagggagtgtgtag91
HSPA1BNM_005346.4gggtcaggccctaccattcaacagtccacctcaaagacaa77
JUNNM_002228.3ccaaaggatagtgcgatgtttctgtccctctccactgcaac62
MDM2NM_002392.5tctgatagtatttccctttcctttgtgttcacttacaccagcatcaa137
MMP10NM_002425.2gcattttggccctctcttccagggtatggatgcctcttg147
SOX9NM_000346.3gtacccgcacttgcacaactctcgctctcgttcagaagtc74

The change in transcriptional profiles during anastasis provides us mechanistic insights into how dying cells could reverse apoptosis (Figure 5). In early anastasis, our data reveals that the regulators of the TGF-β signalling pathway, which control various fundamental cellular and pathological process, including proliferation, cell survival, apoptosis, cell migration, and transformation5962, are upregulated. The activation of the TGF-β pathway is further supported by the upregulation of AP-1 (Jun-Fos)59, as observed here during early anastasis. The up-regulation of the TGF-β pathway can also promote the expression of murine double minute 2 (Mdm2)63,64, an inhibitor of p53 that is also up-regulated during early anastasis30. As p53 plays a critical role in regulating apoptosis and DNA repair65,66, the expression of Mdm2 could not only promote cell survival by inhibiting p53-mediated cell death, but also cause mutations as we have observed in the cells after anastasis30. Expression of Mdm2 can also activate XIAP67, which inhibits caspases 3, 7 and 96873, and therefore, could promote anastasis by suppressing the caspase-mediated cell destruction process. Up-regulation of anti-apoptotic BCL2 protein (Bag3) and heat shock proteins (Hsps) during anastasis can also neutralize pro-apoptotic proteins to promote cell recovery26,74,75. Expression of Hmox1, which encodes heme oxygenase76, could protect dying cells from free radicals that are generated during apoptosis. Notably, the expression of Bbc3, a pro-apoptotic BH3-only gene to encode PUMA (p53 upregulated modulator of apoptosis)77,78, peaks at anastasis (R3-R6), suggesting the sign of anastasis vs apoptosis in the recovering cells during the early stage of the cell recovery process.

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure5.gif

Figure 5. Interaction network of the up-regulated genes during anastasis.

The 33 up-regulated genes during anastasis were selected for analysis using GeneMANIA.

To reverse apoptosis, the recovering cells need to remove or recycle the destroyed cellular components, such as the toxic or damaged proteins that are cleaved by caspases, and dysfunctional organelles like the permeabilized mitochondria. Autophagy could contribute to anastasis, as the recovering cells display up-regulation of Atg12 (Figure 3B, Table 2), which is important to the formation of autophagosome to engulf the materials that are then transported to lysosomes or vacuoles for degradation7982. Sqstm1, which encodes sequestosome 18385 and is up-regulated at R6, could play important role in mediating autophagy and DNA damage response during anastasis. In fact, recently studies reveal that autophagy can be activated by the DNA damage response, and play a role in maintaining the nuclear and mitochondrial genomic integrity through DNA repair and removal of micronuclei and damaged nuclear parts86,87. This could suppress mutagenesis and oncogenic transformation to occur in the cells that reverse apoptosis as we have observed after DNA damage30,31. Autophagy is also implicated in the exosome secretory pathway8890, which could allow rapid clearance of damaged or toxic materials during anastasis through exosomes. Interestingly, our microarray data shows that the recovering cells display up-regulation of potent angiogenic factors such as Vegfa and Angptl4 (Figure 3A and B, Table 1 and Table 2), which promote vascular permeability and angiogenesis9194. This could facilitate anastasis by supplying nutrient and clearing waste products. However, this could also enhance tumour recurrence, progression and metastasis95, when anastasis occurs in cancer cells between cycles of cancer therapy. In fact, our data also reveals the up-regulation of genes involved in cell migration during anastasis30, such as Mmp 9, 10 and 13 (Figure 3B, Table 2) that encode matrix metalloproteinases9699. This could be a stress-inducible response that promotes cell migration, like what we have observed in HeLa cells after anastasis (Supplementary Figure 4)31, which might contribute to wound healing after tissue injury, or metastasis during cancer recurrence100,101.

Change in expression of histone proteins contributes to histone modification, which plays critical role in transcription, DNA replication and repairing102106. At the late stage of anastasis (R6), various histone genes display significant changes in expression (Table 2, Table 3), suggesting potential connection between histone modification and reversal of apoptosis. Interestingly, significant number of histone genes are down-regulated during anastasis (Table 3). Recent study reported histone degradation in response to DNA damage, and that is important for DNA repairing107. As dying cells can reverse apoptosis after DNA damage30,31, reduction of histone gene expression could represent the DNA damage response during anastasis.

Arresting cell cycle during anastasis is important as it can allow damaged cells to be repaired before they restore proliferation. This hypothesis is supported by our microarray data that reveals up-regulation of genes that suppress cell cycle (Figure 3A–C). For example, B-cell translocation gene 1 (Btg1) is an anti-proliferative gene108,109, which is up-regulated during the early anastasis (R3). At later stage of anastasis (R6), other cell cycle inhibitors express, including Cdkn1a which encodes p21 that induces cell cycle arrest and senescence110112, and also Trp53inp1 which encodes tumor protein p53-inducible nuclear protein 1 that can arrest cell cycle independent to p53 expression113. These suggest that cell cycle is suppressed by multiple pathways during anastasis.

We also identified genes that are up-regulated both during apoptosis and anastasis, such as Gadd45g, and Rnu6 (Figure 3C, Table 4). Gadd45g functions in growth arrest and DNA repair114,115, and therefore, could be the cytoprotective mechanism that preserves DNA in the dying cells during cell death induction (R0), and promotes the injured cells to repair when the environment is improved (R3 and R6). Rnu6 encodes U6 small nuclear RNA, which is important for splicing of a mammalian pre-mRNA116119. Upregulation of Rnu6 from R0 to R6 suggests that post-transcriptional regulation could be involved during apoptosis and anastasis. In fact, translational regulation also contributes to anastasis. For example, caspase-3, PARP and ICAD are cleaved in dying cells during apoptosis, and the non-cleaved form of corresponding proteins restores after anastasis (Figure 1B). Interestingly, the mRNA level of caspase-3, PARP and ICAD did not show significant increase during and after anastasis (see Data availability). This suggests the contribution of translational regulation during anastasis.

Our study provides new insights into the mechanisms and consequences of anastasis (Figure 6). Researchers can analyse our microarray data to further identify the hallmarks of anastasis, understand its role, elucidate molecular mechanisms that reverse apoptosis, and develop therapeutic strategies by controlling anastasis. To identify the genes that display specific change on a transcriptional level, software such as Spotfire can be used to view the gene expression pattern at different time points during the reversal of apoptosis54. To study the molecular mechanism of anastasis, Ingenuity Pathway Analysis can be used to create mechanistic hypotheses according to the transcriptional profile120. To identify drugs that modulate anastasis, Connectivity Map can be used to identify small molecules that promote or suppress anastasis based on its gene expression signature121,122. Anastasis could be a cell survival phenomenon mediated by multiple pathways2931,33, so by comparing the gene expression profiles, researchers can study its potential connection to other cellular processes, such as anti-apoptotic pathways, autophagy, and stress-inducible responses82,123127. By searching the molecular signature of anastasis, researchers can study its potential contribution to physiological and pathological conditions, such as recovery from heart failure, wound healing, mutagenesis, tumour evolution, cancer recurrence and metastasis45,100,101,128. Further data analysis will stimulate the generation of hypotheses for future studies involving anastasis. As our understanding of anastasis mechanism expands, it will uncover its potential impacts on physiology and pathology, and offer exciting new therapeutic opportunities to intractable diseases by mediating cell death and survival (Figure 7).

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure6.gif

Figure 6. Up-regulation of genes and potential corresponding pathways during reversal of apoptosis.

05ed1c9a-7fe0-472f-983e-cacf87599af4_figure7.gif

Figure 7. Potential consequences of anastasis.

Data availability

Figshare: Raw data for Tang et al., 2016 “Molecular signature of anastasis for reversal of apoptosis” doi: 10.6084/m9.figshare.4502732

http://dx.doi.org/10.6084/m9.figshare.4502732

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 13 Jan 2017
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Tang HM, Talbot Jr CC, Fung MC and Tang HL. Molecular signature of anastasis for reversal of apoptosis [version 2; peer review: 3 approved]. F1000Research 2017, 6:43 (https://doi.org/10.12688/f1000research.10568.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 09 Feb 2017
Revised
Views
30
Cite
Reviewer Report 10 Mar 2017
Leonard K. Kaczmarek, Department of Pharmacology, Yale School of Medicine, New Haven, CT, USA 
Approved
VIEWS 30
The data presented build on the authors’ earlier studies of reversal of apoptosis. They provide useful information documenting changes in gene expression following 5 hours of exposure to ethanol, an apoptotic stimulus to primary mouse liver cells. The findings only ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Kaczmarek LK. Reviewer Report For: Molecular signature of anastasis for reversal of apoptosis [version 2; peer review: 3 approved]. F1000Research 2017, 6:43 (https://doi.org/10.5256/f1000research.11669.r19460)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
23
Cite
Reviewer Report 10 Feb 2017
Takafumi Miyamoto, University of Tokyo, Tokyo, Japan 
Approved
VIEWS 23
The authors sincerely responded to my comment with deep consideration. ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Miyamoto T. Reviewer Report For: Molecular signature of anastasis for reversal of apoptosis [version 2; peer review: 3 approved]. F1000Research 2017, 6:43 (https://doi.org/10.5256/f1000research.11669.r20082)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Version 1
VERSION 1
PUBLISHED 13 Jan 2017
Views
37
Cite
Reviewer Report 30 Jan 2017
Sanzhen Liu, Department of Plant Pathology, Kansas State University, Manhattan, KS, USA 
Approved
VIEWS 37
The manuscript by Tang et al. was focused on the elucidation of the molecular mechanisms of an important phenomenon, anastasis, through time-course expression profiling. Anastasis was recently discovered and has not been fully studied yet. It's molecular basis remains to ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Liu S. Reviewer Report For: Molecular signature of anastasis for reversal of apoptosis [version 2; peer review: 3 approved]. F1000Research 2017, 6:43 (https://doi.org/10.5256/f1000research.11388.r19503)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
Views
56
Cite
Reviewer Report 20 Jan 2017
Takafumi Miyamoto, University of Tokyo, Tokyo, Japan 
Approved with Reservations
VIEWS 56
This study unravels the gene regulatory network that seems to be involved in the process of anastasis. It is interesting that the authors found various genes that appear to participate in ethanol-induced anastasis, suggesting that the dynamic reconstitution of gene ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Miyamoto T. Reviewer Report For: Molecular signature of anastasis for reversal of apoptosis [version 2; peer review: 3 approved]. F1000Research 2017, 6:43 (https://doi.org/10.5256/f1000research.11388.r19354)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 09 Feb 2017
    Ho Lam Tang, W. Harry Feinstone Department of Molecular Microbiology and Immunology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, USA
    09 Feb 2017
    Author Response
    We thank for the enthusiasm and valuable input from the reviewer, and have made the following changes:
    1. We have included the Western blot data (Figure 1B), which shows
    ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 09 Feb 2017
    Ho Lam Tang, W. Harry Feinstone Department of Molecular Microbiology and Immunology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, USA
    09 Feb 2017
    Author Response
    We thank for the enthusiasm and valuable input from the reviewer, and have made the following changes:
    1. We have included the Western blot data (Figure 1B), which shows
    ... Continue reading

Comments on this article Comments (0)

Version 2
VERSION 2 PUBLISHED 13 Jan 2017
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.