Keywords
HBV/C2, Chronic, Non-recombinant, Bangladesh
HBV/C2, Chronic, Non-recombinant, Bangladesh
The revised version of the manuscript contains very little changes in some sentences that were suggested by the reviewers. The title has also been changed to “Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a HBV infected patient”.
See the authors' detailed response to the review by Mohammad Ariful Islam
See the authors' detailed response to the review by Paul Klapper
See the authors' detailed response to the review by Ashesh Kumar Chowdhury
The burden of chronic liver disease caused by hepatitis B virus (HBV) is increasingly detected at present1. Globally, more than 2 billion people have been infected by HBV2,3 and, according to the World Health Organization (WHO) approximately 257 million were living with HBV in 2017. In Bangladesh, the rate of HBV chronicity is 2–6%4, which makes it relatively higher risk than some infectious diseases, for example, Hepatitis C virus5 , Human immunodeficiency virus6.
HBV genome comprises a partially double-stranded covalently closed circular DNA that encodes four highly overlapping major open reading frames7. Due to the absence of proof-reading activity, the mutation rate of HBV is high8, which may induce the possible recombination events of the strains9. Most chronic HBV cases have a high possibility of causing liver cirrhosis10 and hepatocellular carcinoma11. In Bangladesh, there is scarce of complete genome sequence of HBV chronic strain of subgenotype C2. Hence, we isolated the complete genome of a HBV/C2 strain collected from a patient having HBV infection carrying the virus for a long time.
An HBV-positive plasma sample was collected from a 45-year-old male patient in a tertiary hospital in Dhaka, Bangladesh after obtaining the patient’s written informed consent. The infected patient might have chronic liver disease, as determined by ultrasonography. The patient was diagnosed with the possibility of chronic HBV infection, suggested by the presence of ascitis and enlarged spleen, after the positive reaction of anti-HBc total and with a high viral load in the plasma. However, the patient was not showing signs of jaundice, though was affected by fever, nausea, vomiting and fatigue. The study was approved by the Research Ethics Committee of National Institute of Biotechnology, Bangladesh (NIBREC2015-01). The patient was not taking any antiviral therapy and was diagnosed 1 month prior to obtainment of the plasma sample. HBV DNA was extracted from the sample using the QIAamp MinElute Virus Spin kit (Qiagen, Germany). The complete HBV genome was amplified by six sets of primer pairs used previously in another study12 using a conventional PCR method. The primer sequences and their annealing temperatures were as follows: set 1, forward- AAGCTCTGCTAGATCCCAGAGT, reverse- AGTTGGCGAGAAAGTGAAAGCCTG, 56°C; set 2, forward- CCTATTGATTGGAAAGTATGTCA, reverse- AACAGACCAATTTATGCCTA, 48°C; set 3, forward- GAGACCACCGTGAACGCCCA, reverse- CCTGAGTGCTGTATGGTGAGG, 56°C; set 4, forward- TTCACCTCTGCCTAATCATC, reverse- ATAGGGGCATTTGGTGGTCT, 52°C; set 5, forward- TCAGGCAACTATTGTGGTTTCA, reverse- GGGTTGAAGTCCCAATCTGGATT, 51°C; set 6, forward- GGGTCACCATATTCTTGGGAA, reverse- CGAGTCTAGACTCTGTGGTA, 51°C. For a mixture of 25 µl reaction volume, 12.5 µl of 2X MasterMix (Thermo Fisher Scientific, USA), 1 µl each of forward and reverse primers (IDT, USA), 9.5 µl of nuclease-free water (Thermo Fisher Scientific, USA) and 2 µl of template DNA were used. The condition of the PCR reaction was 1 cycle at 95°C for 10 min, 35 cycles at 95°C for 1 min, with the aforementioned annealing temperatures for 1 min and 72°C for 1 min, and a final cycle for 10 min at 72°C. Sanger sequencing was performed using the BigDye Terminator version 3.1 cycling sequencing kit (Applied Biosystems, USA) by ABI 3130 Genetic Analyser (SeqGen, CA, USA) and by thermal cycler (Sigma-Aldrich, Germany) using the described annealing temperatures as per manufacturer’s instructions after the purification of PCR products using PureLink PCR Purification Kit (Thermo Fisher Scientific, USA), performed in accordance with the manufacturer’s protocol. Next, the sequenced contigs were assembled using the Seqman tool of DNASTAR Lasergene version 7.213.
The subgenotyping and mutation analysis of the sequenced genome were performed using the HBV Geno2Pheno tool version 214 using the default parameters, comparing against the HBV genotypes consensus sequences. Recombination analysis of the sequence was performed using the NCBI genotyping tool. The complete genome was deposited in the GenBank under the accession number MH220971.
Analysis of the complete genome denotes that the isolate studied here, termed NHB17965, comprises HBV genotype C and subgenotype C2 (HBV/C2) with a GC content of 48.77%. Recombination analysis using the NCBI Genotyping tool showed that NHB17965 is a non-recombinant wild-type HBV isolate (Figure 1).

The Simplot diagram was generated using the NCBI Genotyping tool.
The patient was diagnosed with chronic HBV infection. Although, the patient was tested positive 1 month prior to obtainment of the plasma sample, he might be infected much earlier as he had a minor surgery few years back and his brother was positive for HBV years ago. Isolate NHB17965 was observed to have amino acid substitutions H9Y, N13H, I91L, P109S, T128N, I269L and V278I in the polymerase domain and S53L, P120T, I126T and S210N in the small hepatitis B surface protein as analysed by HBV Geno2Pheno tool14, compared against the HBV genotypes consensus sequences. These substitutions may be the results of regular genomic changes to HBV because of a lack of proof-reading activity of the viral reverse transcriptase, and may not signify any danger.
The findings of this study may help clinicians and scientists to gain substantial knowledge about the current genomic substitutions of HBV/C2 and to decide treatments against chronic HBV infections.
Genome of the HBV strain isolated in this study, MH220971.
The study was supported by the National Institute of Biotechnology, Ministry of Science and Technology, Bangladesh.
| Views | Downloads | |
|---|---|---|
| F1000Research | - | - |
|
PubMed Central
Data from PMC are received and updated monthly.
|
- | - |
Competing Interests: No competing interests were disclosed.
Is the work clearly and accurately presented and does it cite the current literature?
Yes
Is the study design appropriate and is the work technically sound?
Yes
Are sufficient details of methods and analysis provided to allow replication by others?
Yes
If applicable, is the statistical analysis and its interpretation appropriate?
Not applicable
Are all the source data underlying the results available to ensure full reproducibility?
Yes
Are the conclusions drawn adequately supported by the results?
Yes
Competing Interests: No competing interests were disclosed.
Competing Interests: No competing interests were disclosed.
Is the work clearly and accurately presented and does it cite the current literature?
Yes
Is the study design appropriate and is the work technically sound?
Partly
Are sufficient details of methods and analysis provided to allow replication by others?
Yes
If applicable, is the statistical analysis and its interpretation appropriate?
Not applicable
Are all the source data underlying the results available to ensure full reproducibility?
Yes
Are the conclusions drawn adequately supported by the results?
Partly
Competing Interests: No competing interests were disclosed.
Is the work clearly and accurately presented and does it cite the current literature?
Yes
Is the study design appropriate and is the work technically sound?
Yes
Are sufficient details of methods and analysis provided to allow replication by others?
Yes
If applicable, is the statistical analysis and its interpretation appropriate?
Not applicable
Are all the source data underlying the results available to ensure full reproducibility?
Yes
Are the conclusions drawn adequately supported by the results?
Yes
Competing Interests: No competing interests were disclosed.
Alongside their report, reviewers assign a status to the article:
| Invited Reviewers | |||
|---|---|---|---|
| 1 | 2 | 3 | |
|
Version 3 (revision) 10 Sep 18 |
read | ||
|
Version 2 (revision) 13 Aug 18 |
read | read | |
|
Version 1 09 Jul 18 |
read | read | |
Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list:
Sign up for content alerts and receive a weekly or monthly email with all newly published articles
Already registered? Sign in
The email address should be the one you originally registered with F1000.
You registered with F1000 via Google, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Google account password, please click here.
You registered with F1000 via Facebook, so we cannot reset your password.
To sign in, please click here.
If you still need help with your Facebook account password, please click here.
If your email address is registered with us, we will email you instructions to reset your password.
If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance.
Comments on this article Comments (0)