ALL Metrics
-
Views
-
Downloads
Get PDF
Get XML
Cite
Export
Track
Research Note
Revised

Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a patient with uncomplicated chronicity

[version 2; peer review: 2 approved, 1 approved with reservations]
PUBLISHED 13 Aug 2018
Author details Author details
OPEN PEER REVIEW
REVIEWER STATUS

Abstract

The burden of chronic hepatitis B virus (HBV) infections is increasingly detected nowadays. Herein, we report a complete genome of HBV subgenotype C2 (HBV/C2) from a patient with chronic HBV infection. Complete genome analysis revealed that the isolated strain was a non-recombinant wild type and had several regular substitutions in the reverse transcriptase domain and small surface proteins of HBV. This study may help clinicians and scientists gain in-depth knowledge on the current substitutions of HBV/C2 genome and to identify potential therapies against chronic HBV infections.

Keywords

HBV/C2, Chronic, Non-recombinant, Bangladesh

Revised Amendments from Version 1

The revised version of the manuscript contains the restructuring and corrections of some sentences raised in reviewer’s comments. Some information about the patient is added to clarify the overall understanding of the manuscript. Some important references are inputted in the revised manuscript considering the improvement of quality of the paper.

See the authors' detailed response to the review by Mohammad Ariful Islam
See the authors' detailed response to the review by Paul Klapper
See the authors' detailed response to the review by Ashesh Kumar Chowdhury

Introduction

The burden of chronic liver disease caused by hepatitis B virus (HBV) is increasingly detected at present1. Globally, more than 2 billion people have been infected by HBV2,3 and, according to the World Health Organization (WHO) approximately 257 million were living with HBV in 2017. In Bangladesh, the rate of HBV chronicity is 2–6%4, which makes it relatively higher risk than some infectious diseases, for example, Hepatitis C virus5 , Human immunodeficiency virus6.

HBV genome comprises a partially double-stranded covalently closed circular DNA that encodes four highly overlapping major open reading frames7. Due to the absence of proof-reading activity, the mutation rate of HBV is high8, which may induce the possible recombination events of the strains9. Most of the HBV cases are chronic, which has a high possibility of causing liver cirrhosis10 and hepatocellular carcinoma11. In Bangladesh, there is scarce of complete genome sequence of HBV chronic strain of subgenotype C2. Hence, we isolated the complete genome of a HBV/C2 strain collected from a patient with chronic HBV infection carrying the virus for a long time.

Methods

Isolation and sequencing

An HBV-positive plasma sample was collected from a 45-year-old male patient in a tertiary hospital in Dhaka, Bangladesh after obtaining the patient’s written informed consent. The infected patient had chronic liver disease, as determined by ultrasonography. The patient was diagnosed with chronic HBV infection, suggested by the presence of ascitis and enlarged spleen, after the positive reaction of anti-HBc total and with a high viral load in the plasma. However, the patient was not showing signs of jaundice, though was affected by fever, nausea, vomiting and fatigue. The study was approved by the Research Ethics Committee of National Institute of Biotechnology, Bangladesh (NIBREC2015-01). The patient was not taking any antiviral therapy and was diagnosed 1 month prior to obtainment of the plasma sample. HBV DNA was extracted from the sample using the QIAamp MinElute Virus Spin kit (Qiagen, Germany). The complete HBV genome was amplified by six sets of primer pairs used previously in another study12 using a conventional PCR method. The primer sequences and their annealing temperatures were as follows: set 1, forward- AAGCTCTGCTAGATCCCAGAGT, reverse- AGTTGGCGAGAAAGTGAAAGCCTG, 56°C; set 2, forward- CCTATTGATTGGAAAGTATGTCA, reverse- AACAGACCAATTTATGCCTA, 48°C; set 3, forward- GAGACCACCGTGAACGCCCA, reverse- CCTGAGTGCTGTATGGTGAGG, 56°C; set 4, forward- TTCACCTCTGCCTAATCATC, reverse- ATAGGGGCATTTGGTGGTCT, 52°C; set 5, forward- TCAGGCAACTATTGTGGTTTCA, reverse- GGGTTGAAGTCCCAATCTGGATT, 51°C; set 6, forward- GGGTCACCATATTCTTGGGAA, reverse- CGAGTCTAGACTCTGTGGTA, 51°C. For a mixture of 25 µl reaction volume, 12.5 µl of 2X MasterMix (Thermo Fisher Scientific, USA), 1 µl each of forward and reverse primers (IDT, USA), 9.5 µl of nuclease-free water (Thermo Fisher Scientific, USA) and 2 µl of template DNA were used. The condition of the PCR reaction was 1 cycle at 95°C for 10 min, 35 cycles at 95°C for 1 min, with the aforementioned annealing temperatures for 1 min and 72°C for 1 min, and a final cycle for 10 min at 72°C. Sanger sequencing was performed using the BigDye Terminator version 3.1 cycling sequencing kit (Applied Biosystems, USA) by ABI 3130 Genetic Analyser (SeqGen, CA, USA) and by thermal cycler (Sigma-Aldrich, Germany) using the described annealing temperatures as per manufacturer’s instructions after the purification of PCR products using PureLink PCR Purification Kit (Thermo Fisher Scientific, USA), performed in accordance with the manufacturer’s protocol. Next, the sequenced contigs were assembled using the Seqman tool of DNASTAR Lasergene version 7.213.

Analysis

The subgenotyping and mutation analysis of the sequenced genome were performed using the HBV Geno2Pheno tool version 214 using the default parameters, comparing against the HBV genotypes consensus sequences. Recombination analysis of the sequence was performed using the NCBI genotyping tool. The complete genome was deposited in the GenBank under the accession number MH220971.

Results and discussion

Analysis of the complete genome denotes that the isolate studied here, termed NHB17965, comprises HBV genotype C and subgenotype C2 (HBV/C2) with a GC content of 48.77%. Recombination analysis using the NCBI Genotyping tool showed that NHB17965 is a non-recombinant wild-type HBV isolate (Figure 1).

c2ff4693-390d-4725-abe7-71486186bdb8_figure1.gif

Figure 1. Recombination analysis of the isolate NHB17965.

The Simplot diagram was generated using the NCBI Genotyping tool.

The patient was diagnosed with chronic HBV infection. Although, the patient was tested positive 1 month prior to obtainment of the plasma sample, he might be infected much earlier as he had a minor surgery few years back and his brother was positive for HBV years ago. Isolate NHB17965 was observed to have amino acid substitutions H9Y, N13H, I91L, P109S, T128N, I269L and V278I in the polymerase domain and S53L, P120T, I126T and S210N in the small hepatitis B surface protein as analysed by HBV Geno2Pheno tool14, compared against the HBV genotypes consensus sequences. These substitutions may be the results of regular genomic changes to HBV because of a lack of proof-reading activity of the viral reverse transcriptase, and may not signify any danger.

The findings of this study may help clinicians and scientists to gain substantial knowledge about the current genomic substitutions of HBV/C2 and to decide treatments against chronic HBV infections.

Data availability

Genome of the HBV strain isolated in this study, MH220971.

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 09 Jul 2018
Comment
Author details Author details
Competing interests
Grant information
Copyright
Download
 
Export To
metrics
Views Downloads
F1000Research - -
PubMed Central
Data from PMC are received and updated monthly.
- -
Citations
CITE
how to cite this article
Shaha M, Sarker PK, Hossain MS et al. Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a patient with uncomplicated chronicity [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2018, 7:1023 (https://doi.org/10.12688/f1000research.15090.2)
NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.
track
receive updates on this article
Track an article to receive email alerts on any updates to this article.

Open Peer Review

Current Reviewer Status: ?
Key to Reviewer Statuses VIEW
ApprovedThe paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approvedFundamental flaws in the paper seriously undermine the findings and conclusions
Version 2
VERSION 2
PUBLISHED 13 Aug 2018
Revised
Views
13
Cite
Reviewer Report 04 Sep 2018
Ashesh Kumar Chowdhury, Department of Immunology, BIRDEM General Hospital, Dhaka, Bangladesh 
Approved
VIEWS 13
The reporting of a sequence analysis of complete genome of subgenotype C2 of hepatitis B virus is new in Bangladesh perspective. The article as ‘research note’ is quite acceptable.

But, regarding the ‘chronic status’ of patient, it ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Chowdhury AK. Reviewer Report For: Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a patient with uncomplicated chronicity [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2018, 7:1023 (https://doi.org/10.5256/f1000research.17379.r37523)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 10 Sep 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    10 Sep 2018
    Author Response
    We would like to thank the reviewer for his constructive comments on the manuscript. Herein, the responses to the reviewer's comments are given.

    From the title- ‘from a patient ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 10 Sep 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    10 Sep 2018
    Author Response
    We would like to thank the reviewer for his constructive comments on the manuscript. Herein, the responses to the reviewer's comments are given.

    From the title- ‘from a patient ... Continue reading
Views
9
Cite
Reviewer Report 21 Aug 2018
Paul Klapper, University of Manchester, Manchester, UK 
Approved with Reservations
VIEWS 9
The authors have made a reasonable attempt to address the points raised in my previous review of this manuscript however a fundamental concern remains. There is no laboratory evidence that this patient had chronic HBV infection, there is only evidence ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Klapper P. Reviewer Report For: Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a patient with uncomplicated chronicity [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2018, 7:1023 (https://doi.org/10.5256/f1000research.17379.r37107)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 10 Sep 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    10 Sep 2018
    Author Response
    We would like to thank the reviewer again for his constructive comments on the manuscript. 

    The manuscript is revised considering the comments and suggestions of the reviewer.
    Competing Interests: No competing interests were disclosed.
COMMENTS ON THIS REPORT
  • Author Response 10 Sep 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    10 Sep 2018
    Author Response
    We would like to thank the reviewer again for his constructive comments on the manuscript. 

    The manuscript is revised considering the comments and suggestions of the reviewer.
    Competing Interests: No competing interests were disclosed.
Version 1
VERSION 1
PUBLISHED 09 Jul 2018
Views
33
Cite
Reviewer Report 07 Aug 2018
Paul Klapper, University of Manchester, Manchester, UK 
Not Approved
VIEWS 33
This paper reports a sequence analysis of a strain of hepatitis B virus. However, there are some aspects of the paper that merit attention. In the Abstract and again in the Introduction the authors state: The number of chronic cases of hepatitis ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Klapper P. Reviewer Report For: Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a patient with uncomplicated chronicity [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2018, 7:1023 (https://doi.org/10.5256/f1000research.16434.r36692)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 13 Aug 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    13 Aug 2018
    Author Response
    We would like to thank the reviewer for his constructive comments on the manuscript. Herein, the responses to the comments are given.
     
    ‘The number of chronic cases of hepatitis ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 13 Aug 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    13 Aug 2018
    Author Response
    We would like to thank the reviewer for his constructive comments on the manuscript. Herein, the responses to the comments are given.
     
    ‘The number of chronic cases of hepatitis ... Continue reading
Views
27
Cite
Reviewer Report 23 Jul 2018
Mohammad Ariful Islam, Jagannath University, Dhaka, Bangladesh 
Approved
VIEWS 27
The overall level of the paper is good: even if it is quite simple, it is well written and some important considerations are highlighted.

The manuscript talks about the complete genome analysis of hepatitis B virus and ... Continue reading
CITE
CITE
HOW TO CITE THIS REPORT
Islam MA. Reviewer Report For: Analysis of the complete genome of hepatitis B virus subgenotype C2 isolate NHB17965 from a patient with uncomplicated chronicity [version 2; peer review: 2 approved, 1 approved with reservations]. F1000Research 2018, 7:1023 (https://doi.org/10.5256/f1000research.16434.r35849)
NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article.
  • Author Response 01 Aug 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    01 Aug 2018
    Author Response
    We would like to thank the reviewer for his constructive comments on the manuscript.

    NHB17965 indicates the sample identification number given by the laboratory. 

    There are no reference sequences used in this ... Continue reading
COMMENTS ON THIS REPORT
  • Author Response 01 Aug 2018
    Modhusudon Shaha, Microbial Biotechnology Division, National Institute of Biotechnology, Dhaka, 1349, Bangladesh
    01 Aug 2018
    Author Response
    We would like to thank the reviewer for his constructive comments on the manuscript.

    NHB17965 indicates the sample identification number given by the laboratory. 

    There are no reference sequences used in this ... Continue reading

Comments on this article Comments (0)

Version 3
VERSION 3 PUBLISHED 09 Jul 2018
Comment
Alongside their report, reviewers assign a status to the article:
Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested
Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit.
Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions
Sign In
If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password.

The email address should be the one you originally registered with F1000.

Email address not valid, please try again

You registered with F1000 via Google, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Google account password, please click here.

You registered with F1000 via Facebook, so we cannot reset your password.

To sign in, please click here.

If you still need help with your Facebook account password, please click here.

Code not correct, please try again
Email us for further assistance.
Server error, please try again.