The identification of high-performing antibodies for FUS (Uniprot ID: P35637)  for use in western blot, immunoprecipitation, immunofluorescence and flow cytometry

Antibodies

All FUS antibodies are listed in Table 2, together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly.²⁶ Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-rabbit and anti-mouse secondary antibodies are from Thermo Fisher Scientific (cat. number A21429 and A21424).

Table 3. Illustrations to assess antibody performance in all western blot, immunoprecipitation, immunofluorescence and flow cytometry.

Applications	Various result scenarios
Western blot
Immunoprecipitation
Immunofluorescence
Flow cytometry

CRISPR/Cas9 genome editing

The HeLa FUS KO clone was generated with low passage cells using an open-access protocol available on Zenodo.org: https://zenodo.org/record/3875777#.ZA-Rxi-96Rv. Two guide RNAs were used to introduce a STOP codon in the FUS gene (sequence guide 1: AGGGAGUCACAAAAGCCACC, sequence guide 2: GGUACGGUGGUGUUGAUGUC).

Cell culture

Both HeLa WT and FUS KO cell lines used are listed in Table 1, together with their corresponding RRID, to ensure the cell lines are cited properly.²⁷ Cells were cultured in DMEM high-glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/mL streptomycin (Wisent cat. number 450201).

Antibody screening by western blot

Western blots were performed as described in our standard operating procedure. HeLa WT and FUS KO were collected in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with 1× protease inhibitor cocktail mix (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 × g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western Blot. BLUelf prestained protein ladder from GeneDireX (cat. number PM008-0500) was used.

Western blots were performed with large 5-16% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau S staining (Thermo Fisher Scientific, cat. number BP103-10) which is scanned to show together with individual western blot. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/mL in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with Pierce ECL (Thermo Fisher Scientific, cat. number 32106) prior to detection with the HyBlot CL autoradiography films (Denville, cat. number 1159T41).

Antibody screening by immunoprecipitation

Immunoprecipitation was performed as described in our standard operating procedure. Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 μL of phosphate-buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0,01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μL of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by two washes to remove unbound antibodies.

HeLa WT were collected in HEPES buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor. Lysates were rocked 30 min at 4°C and spun at 110,000 × g for 15 min at 4°C. One mL aliquots at 1.0 mg/mL of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 mL of HEPES lysis buffer and processed for SDS-PAGE and western blot on a 5-16% polyacrylamide gels.

Antibody screening by immunofluorescence

Immunofluorescence was performed as described in our standard operating procedure.^17–20,23 HeLa WT and FUS KO were labelled with a green and a far-red fluorescence dye, respectively. The fluorescent dyes used are from Thermo Fisher Scientific (cat. number C2925 and C34565). WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37 ^oC, 5% CO₂. Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10 ml) in PBS for 15 min at room temperature and then washed 3 times with PBS. Cells were permeabilized in PBS with 0.1% Triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary FUS antibodies overnight at 4°C. Cells were then washed 3 × 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/mL for 1 hr at room temperature with DAPI. Cells were washed 3 × 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO).

Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40× oil objective (NA = 1.40). Analysis was done using the Zen navigation software (Zeiss). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.1.2) to adjust contrast then assembled with Adobe Illustrator (version 27.3.1).

Antibody screening by flow cytometry

HeLa WT and FUS KO cells were detached, and five million cells were labelled with CellTracker green or violet fluorescent dyes, respectively (Thermo Fisher Scientific, cat. number C7025 and C10094). WT and KO cells were then centrifuged at 300 × g, for 10 min and resuspended in PBS containing 1% bovine serum albumin (BSA) (Sigma-Aldrich, A9647). Cell populations were then combined at a 1:1 ratio, centrifuged and fixed on ice for 20 min using 800 μL of 4% PFA in PBS (Thermo Fisher Scientific, cat. number J19943.K2). Following fixation, 1.2 mL of 1% BSA in PBS was added to the tube, vortexed and centrifuged at 600 × g for 15 min at 4°C. Cells were then permeabilized in 400 μL PBS with 0.1% Triton X-100 (Thermo Fisher Scientific, J63521.AP) for 10 min at room temperature. Following permeabilization 1mL of 1% BSA PBS was added to the tube, vortexed and centrifuged at 600 × g for 15 min at 4^oC. Cells were then blocked in 5% goat serum (Sigma-Aldrich, G6767), 1% BSA in PBS for 30 min on ice. After the blocking step 400,000 cells were aliquoted into individually labelled tubes, centrifuged 600 × g for 15 min at 4°C and incubated in 150 μL of 1% BSA PBS with primary FUS antibodies for 30 min on ice. 500 μL of PBS with 1% BSA was added to each tube, vortexed and centrifuged at 600 × g for 15 min at 4°C. Cells were then incubated with the corresponding Multi-rAb CoraLite^® Plus 647 secondary antibodies (0.83 μg/ml) in 150 μL of PBS containing 1% BSA for 30 min on ice. For mouse primary antibodies Multi-rAb CoraLite Plus 647-goat-anti-mouse was used (Proteintech, RGAM005). For rabbit primary antibodies Multi-rAb CoraLite Plus 647-goat-anti-rabbit was used (Proteintech, RGAR005). 500 μl of PBS containing 1% BSA was then added to each tube, vortexed and centrifuged 600 × g 15 min at 4°C. Tubes were then resuspended in 1 ml of 1% BSA in PBS and data was acquired using the Attune NxT flow cytometer. Data was analysed using FlowJo with the following gates. The cell population was gated on FSC-A vs SSC-A, within that gate single cells were selected by FSC-A vs FSC-H and then KO and WT cells were isolated by BL1-A vs VL1-A using a quadrat gate. Quantification of antibody staining was then observed in the RL1-A channel and histograms merged to demonstrate the staining intensity between the two populations compared to the two secondary only controls. The figure was then assembled using Adobe Illustrator 2024.

Limitations

Inherent limitations are associated with the antibody characterization platform used in this study. Firstly, the YCharOS project focuses on renewable (recombinant and monoclonal) antibodies and does not test all commercially available FUS antibodies. YCharOS partners provide approximately 80% of all renewable antibodies, but some top-cited polyclonal antibodies may not be available through these partners.

Secondly, the YCharOS effort employs a non-biased approach that is agnostic to the protein for which antibodies have been characterized. The aim is to provide objective data on antibody performance without preconceived notions about how antibodies should perform or the molecular weight that should be observed in western blot. As the authors are not experts in FUS only a brief overview of the protein’s function and its relevance in disease is provided. RNA-binding protein experts are responsible for analyzing and interpreting observed banding patterns in western blots and subcellular localization in immunofluorescence.

Thirdly, YCharOS experiments are not performed in replicates primarily due to the use of multiple antibodies targeting various epitopes. Once a specific antibody is identified, it validates the protein expression of the intended target in the selected cell line, confirms the lack of protein expression in the KO cell line and supports conclusions regarding the specificity of the other antibodies. Moreover, the same antibody clones are donated by 2-3 manufacturers (cross-licensed antibodies), effectively serving as replicates and enabling the validation of test reproducibility. All experiments are performed using master mixes, and meticulous attention is paid to sample preparation and experimental execution. In IF, the use of two different concentrations serves to evaluate antibody specificity and can aid in assessing assay reliability. In instances where antibodies yield no signal, a repeat experiment is conducted following titration. Additionally, our independent data is performed subsequently to the antibody manufacturers internal validation process, therefore making our characterization process a repeat.

Lastly, as comprehensive and standardized procedures are respected, any conclusions remain confined to the experimental conditions and cell line used for this study. The use of a single cell type for evaluating antibody performance poses as a limitation, as factors such as target protein abundance significantly impact results.¹⁴ Additionally, the use of cancer cell lines containing gene mutations poses a potential challenge, as these mutations may be within the epitope coding sequence or other regions of the gene responsible for the intended target. Such alterations can impact the binding affinity of antibodies. This represents an inherent limitation of any approach that employs cancer cell lines.