Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer

Swastika Maity; Krishnaprasad Baby; Bharath Harohalli Byregowda; Megh Pravin Vithalkar; Usha Y Nayak; K Sreedhara Ranganath Pai; Yogendra Nayak

doi:10.12688/f1000research.157465.1

Home Browse Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors...

ALL Metrics

-

Views

-

Downloads

Get PDF

Get XML

Export

▬

✚

Research Article

Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer

[version 1; peer review: 1 approved with reservations, 1 not approved]

Swastika Maity¹, Krishnaprasad Baby¹, Bharath Harohalli Byregowda¹, [...] Megh Pravin Vithalkar¹, Usha Y Nayak², K Sreedhara Ranganath Pai¹, Yogendra Nayak ¹

Swastika Maity¹, Krishnaprasad Baby¹, [...] Bharath Harohalli Byregowda¹, Megh Pravin Vithalkar¹, Usha Y Nayak², K Sreedhara Ranganath Pai¹, Yogendra Nayak ¹

PUBLISHED 21 Nov 2024

Author details Author details

¹ Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India
² Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India

Swastika Maity
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing – Original Draft Preparation

Krishnaprasad Baby
Roles: Formal Analysis, Methodology, Validation

Bharath Harohalli Byregowda
Roles: Formal Analysis, Methodology, Writing – Review & Editing

Megh Pravin Vithalkar
Roles: Formal Analysis, Methodology, Visualization

Usha Y Nayak
Roles: Resources, Supervision, Validation

K Sreedhara Ranganath Pai
Roles: Conceptualization, Supervision, Validation

Yogendra Nayak
Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Methodology, Supervision, Writing – Review & Editing

OPEN PEER REVIEW

REVIEWER STATUS

This article is included in the Manipal Academy of Higher Education gateway.

Abstract

Background

Non-small-cell lung cancer (NSCLC) is a highly morbid disease. Chemotherapy for NSCLC lacks specificity and efficacy mainly because of drug resistance. The current study aimed to explore computational tools to target allosteric epidermal growth factor receptor (EGFR) sites and screen for the top molecules in vitro and in vivo xenograft models.

Methods

Molecular docking, virtual screening, and molecular dynamic studies revealed that acenocoumarol and silodosin are the top two allosteric EGFR inhibitors. They were further tested for cytotoxicity, apoptosis, cell cycle, and gene expression by qPCR, western blotting, A549 cell xenograft anti-proliferative activity, and tumor regression efficacy analysis.

Results

Acenocoumarol and silodosin exhibited cytotoxicity in A549 and IMR-90 cells at concentrations below 50 and 80 μM, respectively. Acenocoumarol and silodosin induced S-phase and G2/M-phase arrest in A549 cells in the cell cycle analysis. Both drugs showed early apoptosis at their IC50 doses (acenocoumarol 50 μM and silodosin 25 μM). KRAS (Kirsten rat sarcoma viral oncogene homolog) and ERK2 (extracellular signal-regulated kinase 2) gene regulation in A549 cells was confirmed using qPCR. KRAS and ERK2 activities were quantified by western blot analysis. In the xenograft study, tumor size, body weight, and organ weight were significantly attenuated by the test drugs compared with the standard cisplatin. Immunoblotting and western blot results of the A549-xenograft tissue indicated downregulation of KRAS and ERK2. Furthermore, the test drugs have upregulated caspase-3 gene expression.

Conclusion

The drugs acenocoumarol and silodosin downregulate KRAS and ERK2 both in cell line and in Xenograft model. KRAS and ERK2 are associated with EGFR inhibition. Hence, acenocoumarol and silodosin can be further explored for repurposing studies in human trials.

Keywords

Allosteric EGFR inhibitor, NSCLC, Acenocoumarol, Silodosin, Drug repurposing

Corresponding author: Yogendra Nayak

Competing interests: No competing interests were disclosed.

Grant information: Swastika Maity received an ICMR Senior Research Fellowship (ICMR-SRF #45/33/2019/PHA/BMS). The authors are thankful to the Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, for facilitating the computer simulations. Schrodinger's Software and Computers were procured under a grant from DST-SERB, New Delhi, to Usha YN (EMR/2016/007006).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2024 Maity S et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite: Maity S, Baby K, Byregowda BH et al. Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2024, 13:1398 (https://doi.org/10.12688/f1000research.157465.1) First published: 21 Nov 2024, 13:1398 (https://doi.org/10.12688/f1000research.157465.1) Latest published: 21 Nov 2024, 13:1398 (https://doi.org/10.12688/f1000research.157465.1)

Introduction

The surface protein receptor tyrosine kinase (TK) and epidermal growth factor receptor (EGFR) are targets for many drugs, particularly for treating lung cancer.¹ Mutation and alteration of EGFR in the cell lead to the development of NSCLC. Exon-19 multi-nucleotide frame deletion leads to the dimerization of four amino-acid sequences in the N-lobe of the EGFR complex, leading to single L858R and T750M or double T790M- L858R mutation condition.² A single nucleotide substitution on Exon-21 in the EGFR site leads to ATP site activation, resulting in the replacement of arginine with leucine at L858M, causing a cancerous lung condition. In NSCLC, the Cys797 mutation to serine (C797S) occurs in the EGFR moiety.³ One of the major problems of EGFR-TK is autophosphorylation, leading to signal transduction pathways that activate the ATP region of the protein due to amino acid activation in the N-lobe of the EGFR complex, leading to an unstable EGFR moiety, causing cancerous growth in the cells.⁴ Therefore, targeted therapy against EGFR overactivity may be effective for treating NSCLC. Currently, the first-generation FDA-approved EGFR therapies are gefitinib and erlotinib, which bind to the ATP site of EGFR, but they fail to inhibit autophosphorylation due to the T790 mutation occurrence.⁵ Afatinib and dacomitinib, second-generation FDA-approved drugs, target the inactive site in EGFR and enzymatically inhibit the T790 mutation. The problem with these molecules is that they only recognize the dimeric state of EGFR and thus fail to stop EGFR overexpression in the monomeric state.⁶ The third-generation drug, osimertinib, has a pyrimidine moiety that covalently binds to the ATP site of EGFR. This leads to the selective inhibition of T790 expression. However, with long-term use, third-generation EGFR inhibitors show C797 secondary mutations.⁷ Tumor complexity and adaptive cell pathways for signalling in NSCLC, particularly involving the activation of various signalling pathways, such as amplification of MET/HER2, RAS-MAPK, or RAS-PI3K pathways, activate novel fusion events and histological or phenotypic transformation.^8,9 Specific mutations, such as G796R, G796S, G796D, and L792H, and less prevalent mutations in exon 20 were linked with osimertinib resistance. Mutations such as C797S disrupt and weaken the covalent bond that Cys797 forms with osimertinib, preventing it from effectively targeting the mutant EGFR and thus conferring resistance to the drug.¹⁰

Fourth-generation drug development involves allosteric site inhibition of EGFR. Mutant-specific allosteric inhibitors of EGFR, such as EAI001, have been found to bind to sites beyond the EGFR allosteric site. This molecule was optimized to yield EAI045, which had potency towards L858R/T790M mutations compared to wild-type EGFR. Researchers have designed and optimized allosteric EGFR inhibitors that bind to allosteric sites in the EGFR tyrosine kinase domain outside the ATP domain and have emerged as potential treatment strategies for EGFR-mutant cancers.¹¹ The main factor for choosing fourth-generation NSCLC drugs or allosteric EGFR inhibitors is that it reduces the chances of “undruggable” protein-ligand moiety formation, thus reducing the chance of adverse reactions of such drugs.¹² In this study, we used computational tools to identify acenocoumarol and silodosin as top-2 allosteric EGFR inhibitors.¹³ These molecules were further evaluated for their pharmacological efficacy against NSCLC.

Methods

Cell culture and maintenance

A549 cells (human lung carcinoma alveolar epithelial squamous cells) and IMR-90 (fibroblasts isolated from normal fetal lungs) were procured from American-type cell culture (ATCC^®), and stock cells were cultured in RPMI 1640 medium (Life Technologies, Invitrogen, catalogue: 2187008), supplemented with 10% inactivated Fetal Bovine Serum (FBS, Merck Catalogue F7524), 100 IU/ml penicillin, and 100 μg/ml streptomycin (Thermo Fisher Scientific^®) in a humidified atmosphere of 5% CO₂ at 37^oC until confluent. The cells were dissociated with cell dissociating solution containing 0.2% trypsin (Invitrogen; catalog R-001-100), 0.02 % EDTA, and 0.05% glucose in PBS. Further, 50,000 cells/well were seeded in a 96-well plate and incubated for 24 hrs at 37^oC, 5 % CO₂ incubator (MIC-80; Microsil India Pvt. Ltd.) The cell viability is checked using a hemocytometer (Rohem Silverline Counting Chamber). The required amount of cells were further cultured in a T75 culture flask (Thermo Fisher Scientific).¹³

Cytotoxicity assay using MTT reagent

The top molecules from the in silico studies, danusertib, bifonazole, clopidogrel, acenocoumarol, silodosin, panobinostat, and standard doxorubicin were procured from TCI^® India. The stock solution of test compounds 10 mM stocks was prepared using DMSO (dimethyl sulfoxide, TCI India). Serial two-fold dilutions were prepared from 100 μM to 3.125 μM using RPMI 1640 plain media for respective treatments.¹³ Cytotoxicity in A549 and IMR-90 cells were carried out using MTT (3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide) reagent.¹⁴ The monolayer cell culture was trypsinized and the cell count was adjusted to 5 × 10⁵ cells/ml using respective media containing 10% FBS. To each well of the 96-well plate, 100 μl of the diluted cell suspension (50,000 cells/well) was added. After 24 h, when a partial monolayer was formed, the supernatant was flicked off, washed the monolayer once with medium and 100 μl of different test concentrations of test drugs were added onto the partial monolayer in microtiter plates. The plates were then incubated at 37^oC for 24 h in 5% CO₂ atmosphere. After incubation, the test solutions in the wells were discarded, and 100 μl of MTT (5 mg/10 ml in PBS) was added to each well. The plates were incubated for 4 h at 37^oC in 5% CO₂ atmosphere. The supernatant was removed, and 100 μl DMSO was added, and the plates were gently shaken to solubilize the formed formazan.¹⁵ Absorbance was measured using a microplate reader (BMG LABTECH^®) at 590 nm. The percentage growth inhibition was calculated using the following formula

% Inhibition = ((OD of Control - OD of sample) / OD of Control) \times 100 .

The half maximal inhibitory concentration (IC₅₀) values for cytotoxicity tests were derived from non-linear regression analysis performed using GraphPad Prism8.0 (Graph pad, San Diego, USA). Alternatively, R-program can also be used. The results were compared between groups. From the cytotoxicity results, we selected the best drugs, acenocoumarol and silodosin, for further testing.

Apoptosis assay using propidium iodide (PI) and Annexin V-FITC staining

A549 cells (1 × 10⁶ in RPMI buffer), were used in this study. The plates were analyzed using a flow cytometer (FACS Calibur, BD Biosciences, San Jose, USA). After 18 h of incubation, the floating cells were replaced with the new medium. Control, standard and test samples at different concentrations were added, followed by induction of apoptosis. Cells were scraped and 1 ml of medium was pipetted to the wells. After the cells were washed twice with cold PBS, they were resuspended in a binding buffer at 1 × 10⁶ cells/ml. The cell suspension was portioned to 500 μl, to which 5 μl of Annexin V (Annexin V, FITC detection kit, Sigma-Aldrich^®) and 10 μl of propidium iodide (Sigma-Aldrich) were mixed. The plates are stored in the dark for 15 min, followed by analysis with a flow cytometer. The quadrants were created based on viable cell markers with different colors.¹⁶ Gating was performed, and cell apoptosis was measured and compared in the different treatment groups.

Cell cycle analysis

A549 cells (1 × 10⁶ cells/ml) were cultured and kept at 6 well plates with 2 ml of RPMI medium and incubated for 24 h. It was then subjected to treatment with the test drugs acenocoumarol (25 and 50 μM), silodosin (12.5 and 25 μM), and standard doxorubicin (25 μM) were incubated for 24 h. The cells were then harvested and centrifuged at 2000 rpm for 5 min at room temperature, and the supernatant was discarded carefully, retaining the cell pellet. The cell pellet was washed by resuspending in 2 ml of 1XPBS. The washing was repeated another time with the same conditions. The supernatant was then discarded. From the pellet, the cells were fixed by resuspending in 300 μl of Sheath fluid (BD Bioscience^®, catalogue no:342003), followed by the addition of 1 ml of chilled 70% ethyl alcohol drop by drop with continuous gentle shaking and another 1 ml of chilled 70% ethyl alcohol added at once. The cells were then stored at 4°C for or overnight. Post fixing, the cells were centrifuged at 2000 rpm for 5 min. The cell pellet was washed twice with 2 ml of cold 1X PBS. The cell pellet was then resuspended in 450 μl of sheath fluid containing 0.05 mg/ml PI (Sigma-Aldrich catalogue no: P4864), and 0.05 mg/ml RNaseA (Sigma-Aldrich, catalogue no: P4864) and incubated for 15 min in the dark. The percentage of cells in different stages of the cell cycle in compounds treated and untreated populations were determined using FACS Caliber (BD Biosciences, San Jose, CA).¹⁷

Western blot quantification KRAS and ERK2

A549 cells (10 × 10⁶ cells/2 ml) were cultured in RPMI medium, added to P35 dish, and incubated till 80% confluency. Drug treatment with acenocoumarol (25 and 50 μM), silodosin (12.5 and 25 μM), and standard doxorubicin (25 μM) were were incubated for 24 h. The protein was isolated post-harvesting by washing with PBS solution twice. The cell pellet was suspended in 300 μl of Radioimmunoprecipitation assay (RIPA) buffer (Thermo-Fisher Scientific) with 1X protease inhibitor (Sigma-Aldrich). The cells were incubated for 30 min, but every 5 min, the suspension was mixed. Then, cells were centrifuged at 10,000 rpm for 12 min and protein lysates were collected. The protein lysates were mixed with 5X loading dye and heated for 2 min at 95°C. Further, it was loaded with 10% and 15% sodium dodecyl sulphate polyacrylamide gel (SDS-PAGE) using Mini protean Tetra cell (Bio-Rad). The nitrocellulose membrane (0.2 μM) (Bio-Rad) was equilibrated in transfer buffer for 10 min. Protein transfer was done for 15 min in the Turbo Transblot (Bio-Rad) apparatus. The blot was blocked in 3% bovine serum albumin (BSA) in tris-buffered saline with Tween 20 (TBST, Thermo-Fisher Scientific, Catalogue no. A11008) for 1 h. The blot was incubated with 2° Ab (anti-Rabbit or anti-Mouse IgG-HRP (horseradish peroxidase, Thermo-Fisher Scientific) at dilution 1:10000 for 1 h. The blot was rinsed with enhanced chemiluminescence (ECL) reagent (Thermo-Fischer Scientific), for 1 min in the dark, and the images were captured between 0.5 to 5 s exposure in Chemidoc XRS and imaging system (Bio-Rad).¹⁷ The protein expression levels of KRAS and ERK2 were measured, keeping glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as loading control in this study and the fold regulation was calculated.

KRAS and ERK2 gene regulation by qPCR

Treated A549 cells were scraped and washed with sterile PBS, followed by centrifugation at 12,000 rpm for 5 min at 4°C. The supernatant was discarded, and 0.4 ml of TRIzol (Invitrogen - Life Technologies^®) was added, mixed for 1 min, and allowed to stand for 10 min at room temperature. Chloroform (0.25 ml per 0.4 ml of TRIzol) was added, and the mixture was vortexed for 15 s. The tube was left to stand for 5 min, after which it was centrifuged at 12,000 rpm for 15 min at 4°C. The aqueous phase was carefully transferred to a new sterile microcentrifuge tube. Isopropanol (0.5 ml) was added, gently mixed for 30 s, and incubated at -20°C for 20 min. The mixture was centrifuged at 12,000 rpm for 10 min at 4°C. After removing the supernatant, the RNA pellet was washed with 0.5 ml of 70% ethanol and centrifuged at 12,000 rpm at 4°C. The supernatant was discarded, and the RNA pellet was air-dried. The pellet was resuspended in 20 μl of diethylpyrocarbonate (DEPC)-treated water, and the total RNA yield was quantified using SpectraDrop (SpectraMax i3x, Molecular Devices, USA). cDNA was synthesized from 500 ng of RNA using the PrimeScript RT reagent kit (Takara Bio) with oligo (dT) primers (Thermo-Fisher), according to the manufacturer’s instructions, in a reaction volume of 20 μl. The cDNA synthesis was performed at 50°C for 30 min. The synthesized cDNA was used for real-time polymerase chain reaction (RT-PCR) analysis. Each 20 μl PCR mixture contained 1.4 μl of cDNA, 10 μl of SYBR Green Master Mix (Thermo Fisher Scientific), and 1 μM of specific forward and reverse primers for the target genes ( Table 1).¹³ The PCR reaction began with enzyme activation at 95°C for 2 min, followed by 39 cycles of denaturation at 95°C for 5 s, and annealing/extension at the appropriate temperature for 30 s. A secondary denaturation at 95°C for 5 s was performed, followed by a melt curve analysis from 65°C to 95°C in 5°C increments. Fold expression or regulation was calculated and compared between treated groups.^18,19

Table 1. Primer details for KRAS and ERK2 fold regulation in A549 cells.

Sr. No.	sequence	Primer	Base pairs	Annealing temperature
1	TGGCACCCAGCACAATGAA	Beta actin	44	50
1	CTAAGTCATAGTCCGCCTAGAAGCA	Beta actin	44	50
2	CACGGTCATCCAGTGTTGTC	KRAS	40	50
2	CACCACCCCAAAATCTCAAC	KRAS	40	50
3	CCGACATCTCAGGTTGGATT	ERK2	40	58
3	GGTCTGTTTTCCGAGGATGA	ERK2	40	58

Tumor regression in A549-Xenograft mouse model

The study was performed with prior approval from Institutional Animal Ethics Committee (IAEC) approval and as per the guidelines of the CPCSEA, and followed ARRIVE 2.0 checklist.¹³ Nude mice (n=16, four groups) were used for the Xenograft induction and treatment. A549 cells at a sub-confluent level were harvested, and viable cells were counted using a haemocytometer. Post viability check, a single cell suspension of 5 x10⁷ cells/ml was prepared in serum-free media and mixed in matrigel at a 1:1 ratio. All the mice were subcutaneously injected with 0.2 ml of cell suspension in the region above the right flank region.^20,21 Tumor size was analyzed using digital Vernier callipers. Treatment with was started when the tumor size was 100-150 mm³ (2 weeks). Treatment with the test drugs and standard drugs was initiated as per the respective pre-determined doses, the positive control was intravenously administered, and test drugs were administered to animals in groups 3 and 4. Tumor length and width were measured every alternate day using Vernier calipers, and tumor volume was calculated. Once the tumor size reached the desired volume, ≈100-150 mm³ (3 weeks), the tumor volume was noted and randomly sorted into four groups, each consisting of four animals. The treatment groups contained the tumor control group, to which normal saline was administered orally; the positive control group mice were treated with 4 mg/kg cisplatin (TCI, India; CAS: 15663-27-1; catalogue no: D3371), and the test sample or treatment groups III and IV received an oral dose of silodosin at 8 mg/kg and acenocoumarol at 0.2 mg/kg till 21 days. At the end of the study, the mice were euthanized. The parameters such as tumor volume, % tumor growth inhibition, % change in body weight, organ weights, mean tumor weight.²² All efforts were made to reduce the suffering of the animals throughout the study phase.¹³

qPCR analysis of caspase-3 regulation in the Xenograft

The caspase-3 regulation in A549-xenograft tissue gene expression were analyzed and compared between the treatment groups.²³ The specific forward and reverse primers for the target genes are represented in Table 2.

Table 2. The primer sequence for gene regulation of Caspase-3 in A549 xenograft tissue.

Sr. No.	sequence	Primer	Base pairs	Annealing temperature
1	TGGCACCCAGCACAATGAA	Actin	45	60
1	CTAAGTCATAGTCCGCCTAGAAGCA	Actin	45	60
2	CAACGTCCCCTCTGAAAAA	Caspase-3	40	45
2	TGGAATTGATGCGTGATGTT	Caspase-3	40	45

Western blot for KARS and ERK2 in the Xenograft

Western blot analysis was performed and the Ref. 24. The respective markers were analyzed in this study.

Histopathology of the Xenograft

The histopathology, hematoxylin and eosin (H&E) staining of tumour tissue, heart, kidney, liver, lung, and spleen were carried out.²⁵ Cell infiltration, cell rupture, and cellular confluence were analyzed to identify the effects of the treatment group compared to the control group.

Results

Cytotoxicity assay

In A549 cells, cytotoxicity analysis by MTT assay showed potent cell death in all treated drugs. Silodosin, danusatib, acenocoumarol, and panobinostat were more potent than the others. The IC₅₀ values are presented in Figure 1. The IC₅₀ in IMR-90 cells are presented in Figure 2. Acenocoumarol and silodosin were more potent than panobinostat and danusatib. Based on the IC₅₀ of the drugs acting on both cell lines, acenocoumarol and silodosin were selected for further in vitro analysis to analyze their efficacy in treating NSCLC and their antagonistic activity as EGFR allosteric inhibitors.

Figure 1. Cytotoxicity of top molecules by MTT assay using A549 cells.

Figure 2. Cytotoxicity of top molecules by MTT assay using IMR-90 cells.

Legend: The data presented by treatment groups is compared against control and doxorubicin. Drugs such as Bifonazol and clopidogrel did not show IC₅₀, and hence, they are not represented in the figure.

Apoptosis in A549 cells by acenocoumarol and silodosin

Cell activity was observed in all four quadrants compared with that in the control group. The control group showed activity in the first quadrant, indicating the presence of highly viable cells ( Figure 3). This result reflects a significant decrease in cells due to the effect of treatment. The acenocoumarol treatment at 25 μM and 50 μM has induced 20.25%, 36.9% early apoptosis and 11.28%, 6.14% late apoptosis, whereas sample silodosin showed 33.49%, 36.09% early apoptosis and 16.21%, 24.84% late apoptosis at 12.5 μM and 25 μM treatment in A549 cells. Standard doxorubicin at 25 μM has shown total apoptosis of 54.24% in A549 cells ( Figure 4). The PI flow cytometry method on A549 cells in the treatment groups showed increased cell apoptosis compared to the control group. Groups such as acenocoumarol and silodosin showed earlier apoptosis when compared to doxorubicin. Silodosin at 25 μM induced more apoptosis than other treatments at different doses, as determined by Annexin V-FITC and propidium iodide (PI) staining and flow cytometry analysis.

Figure 3. Flow cytometry plots for apoptosis detection in A549 cells.

Legend: The experimental groups: vehicle control, standard control (Doxorubicin 25 μM), and Treatment groups, namely Acenocoumarol at concentrations 25 μM and 50 μM, silodosin at concentrations 12.5 and 25 μM. The viable cell population was determined at the bottom left of the quadrant of the plot. Early apoptotic cells were identified at the bottom right quadrant, and late apoptotic cells were indicated at the top right quadrant.

Figure 4. FACS analysis of apoptosis detection in A549 cells.

Legend: The x-axis presents the treatment groups. Doxorubicin was the standard control. The y-axis represents the percentage of apoptosis activity. The graph shows the effect of treatment groups on checking viable cells, early apoptosis, late apoptosis and necrotic cell analysis. The data is presented by two-way ANOVA without replicas compared to doxorubicin with Mean±SEM. p<0.05, ** and p<0.5, *; compared to doxorubicin 25 μM.

Effects of acenocoumarol and silodosin on A549 cell cycle

The separation of cancer cells in the G0/1, S, and G2/M phases was demonstrated using flow cytometry analysis based on the fluorescence intensity of PI-stained cancer cells. The control group contained cells in the G0/G1 phase. The treatment of A549 cells at the concentrations of 25μM and 50μM with Sample acenocoumarol resulted in S phase and G2M phase arrest of 4.93%, 25.29%, and 10.19%, 15.15%, respectively, and Sample Silodosin has shown 13.7%, 33.37% S phase arrest, 14.82%, 19.43% G2M phase arrest at test concentrations 12.5 μM and 25 μM, respectively, in A549 cells. Standard doxorubicin at 25 μM induced G2M arrest of 31.61% and S phase arrest of 20.92%, respectively, in A549 cells. The test drugs showed significant G1 and S peaks compared with the standard control ( Figures 5 and 6). Acenocoumarol and silodosin treatment at 50 μM and 25 μM induced a significant decrease in the percentage of cells in the G1 phase, and an accumulation of cells in the S and G2/M phases of the cell cycle indicated cell cycle arrest at the S and G2M phase.

Figure 5. Flow cytometry plots for cell cycle analysis in A549 cells.

Legend: Cell cycle activity in A549 cells with respective treatment conditions. The x-axis presents the propidium iodide-induced fluorescence; the y-axis presents the cell frequency. The stages of the cell cycle are marked as a: Go/G1, b: S, c: G2 M and d: SUB Go, respectively. Doxorubicin 25 μM, is the standard used for comparison.

Figure 6. FACS analysis of Cell cycle arrest in A549 cells.

Legend: Cell cycle stages are presented as SUB Go, Go/G1, S and G₂ M phases marked with different colours. Vehicle control, Standard control (Doxorubicin 25 μM), Treatment groups namely Acenocoumarol (25 μM and 50 μM), Silodosin (12.5 and 25 μM). The data was analysed by two-way ANOVA without replicas compared to doxorubicin with Mean ± SEM. p<0.05, ** and p<0.5, *; compared to doxorubicin 25 μM.

KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin

The Western blot results of A549 cells treated with acenocoumarol at 25 and 50 μM concentrations suggested that KRAS and ERK2 were downregulated by 2.12-, 3.50-, 1.04-, 1.68-fold, respectively. KRAS expression was found to be downregulated in cells treated with Silodosin at 12.5 and 25 μM by up to 1.08 and 1.71 folds. ERK2 expression was upregulated when treated with Silodosin at 12.5 μM and 25 μM ( Figure 7). The standard group showed downregulation of both KRAS and ERK2 by up to 3.02 and 2.41, respectively.

Figure 7. Western blot analysis of GAPDH, ERK2 and KRAS in A549 cells.

Legend: A: Representation of western blot gels. The treatment groups are presented as lane a: vehicle control, b: acenocoumarol 25 μM, c: acenocoumarol 50 μM, d: silodosin 12.5 μM, e: silodosin 25 μM, f: standard control, doxorubicin 25 μM. B: Fold analysis to determine the level of expression.

KRAS and ERK2 gene regulation by acenocoumarol and silodosin

qPCR or quantitative PCR analysis of the target genes KRAS and ERK2 was carried out, and fold regulation was determined. The results suggested decreased KRAS and ERK2 expression in cells treated with acenocoumarol at 50 μM compared to the control, with 2.10- and 1.57-fold expression. Acenocoumarol at 25 μM showed only a negligible effect on KRAS expression, whereas ERK2 was observed to be positively upregulated 0.31-fold ( Figure 8) compared to the control. The gene expression of both KRAS and ERK2 was upregulated in cells treated with silodosin at 12.5 μM. The expression was observed to decrease as the treatment concentration increased, with 6.54- and 1.72-fold in KRAS and ERK2 expression, respectively. The standard treatment has shown decreased expression by 3.12- and 1.49-fold in KRAS and ERK2 expression ( Figure 9).

Figure 8. Relative expression by fold change analysis of KRAS and ERK2 gene in A549 cells.

Legend: The x-axis shows the drug treatments and the y-axis shows a fold change frequency by qPCR analysis. The treatment groups are vehicle control and standard control i.e. Doxorubicin 25 μM. Treatment groups namely Acenocoumarol at concentrations 25 μM and 50 μM, and silodosin at concentrations 12.5 and 25 μM.

Figure 9. The tumour growth in A549 xenograft tumour model.

Legend: A. Tumor growth profile (mm³) during the treatment period of 21 days; B. Tumour induction in nude mice and its growth profile at the end of the study. In the disease control group (cisplatin 4 mg/kg), silodosin (8 mg/kg), and acenocoumarol (0.2 mg/kg), Values are represented as Mean ± SEM (n= 4). p<0.5 significant compared to the vehicle control.

Tumor regression efficacy in A549 xenograft by acenocoumarol and silodosin

The mice with A549 Xenografts treated with Cisplatin showed a tumor growth inhibition up to 73.57 ± 0.88 whereas, the test drugs showed inhibition up to 22.69 ± 3.79 and 45.3 ± 5.32% at 8 mg/kg and 0.2 mg/kg respectively (p<0.05, p<0.5) ( Figure 9). The tumor growth profile of all treatment groups was significantly reduced, indicating that the test drug showed good efficacy against NSCLC. Tumor growth inhibition was significant compared to that in control mice ( Figure 10). Other organ growth profiles suggested that the groups with treatment induction had good growth profiles compared with the disease control groups ( Figure 11).

Figure 10. Percentage of tumour growth inhibition in the A549 xenograft tumour model.

Legend: The disease control group i.e. cisplatin (4 mg/kg) showed significant tumour growth with p<0.001; the treatment groups silodosin 8 mg/kg and acenocoumarol (0.2 mg/kg) showed significant tumour growth inhibition profile against vehicle control (p<0.001). Data represented in Mean ± SEM was calculated.

Figure 11. Organ weights of the mice with A549 xenograft tumour.

Legend: The vehicle control is disease-induced mice, cisplatin (4 mg/kg), silodosin (8 mg/kg), and acenocoumarol (0.2 mg/kg). Values are represented as Mean ± SEM, p< 0.05 is considered significant compared to vehicle control.

Caspase-3 regulation in A549 Xenograft

qPCR analysis of the A549 xenograft treated with silodosin and acenocoumarol at pre-determined concentrations suggested the effective upregulation of Caspase-3 gene expression in tumor tissue samples. The tumor tissue from silodosin and acenocoumarol showed upregulation of Caspase-3 gene expression by 5.82- and 1.49-folds ( Figure 12), respectively, when compared to the control. In contrast, standard treatment with cisplatin resulted in a 1.71-fold increase in expression. Overall, the results suggest that the test sample treatment with silodosin and acenocoumarol at the respective concentrations was effective in the A549 xenograft model.

Figure 12. Relative expression of caspase-3 gene in xenograft tumour tissue.

Legend: The treatment groups namely Silodosin (8 mg/kg), acenocoumarol (0.2 mg/kg) and the disease control group, cisplatin (4 mg/kg) were compared to vehicle control (medium).

KRAS and ERK2 enzyme inhibition by acenocoumarol and silodosin

In the blot analysis of the treatment groups, Acenocoumarol 0.2 mg/kg and silodosin (8 mg/kg) were analyzed for KRAS and ERK2 enzyme fold regulation ( Figure 13). The blots (Figure 13B) show upregulation of KRAS, whereas ERK2 was downregulated very little, except with acenocoumarol treatment. Acenocoumarol showed better activity than the standard and silodosin treatments did.

Figure 13. Expression analysis of GAPDH, KRAS and ERK2 in xenograft tumor model.

Legend: A: The treatment groups, namely Silodosin (8 mg/kg), acenocoumarol (0.2 mg/kg) and the disease control group, cisplatin (4 mg/kg), were compared to vehicle control (medium). B: The enzymatic degradation study of KRAS, GAPDH and ERK2 marker. The groups evaluated for fold regulation were a,b: vehicle control; c,d: disease control; e,f: Silodosin (8 mg/kg) and g,h: acenocoumarol: (0.2 mg/kg).

Histopathology analysis of Xenograft tissue

Tumor analysis of the histopathology test ( Figure 14) showed that A/group I: Normal architecture was observed. B/group II: Necrosis with moderate mononuclear cell infiltration. C/group III: mild necrosis with mild mononuclear cell infiltration. D/group IV: moderate mononuclear cells. Silodosin and acenocoumarol showed good anti-NSCLC activity compared with the disease control group. The arrows in Figure 14 show cell infiltration/inflammation. The treatment groups showed less cell infiltration than the vehicle-disease control group, indicating suppression of cancerous activity.

Figure 14. Histopathology analysis of organs obtained from xenograft model.

Legend: A: lungs, B: Tumor, C: Liver and D: Kidney.

Discussion

EGFR is the major oncogene driver in NSCLC, and EGFR-targeted therapy has the potential to deliver greater suppression of aggressive NSCLC compared to cytotoxicity-based pharmacotherapy.²⁶ Drugs that target the allosteric site of EGFR-TK, disrupt the cell-signalling cascade and alter cellular function.²⁷ The allosteric site has attracted significant interest from researchers and is now regarded as a highly promising target for developing anti-NSCLC drugs. Therefore, this study highlights the significance of inhibiting the EGFR allosteric site, which intersects with the TK receptor-ligand interaction.²⁸ It has also been stated that anaplastic lymphoma kinase (ALK), reactive oxygen species (ROS1), kinase-renin-angiotensin system (KRAS), protein kinase B (PKB), or (AKT) are other validated tissue biomarkers in NSCLC due to its downregulation of EGFR kinase in cell proliferation.²⁹ Targeting the allosteric site stabilizes the protein complex, influencing the binding efficiency of the primary ligand. This inactivates the protein and reduces the responsiveness to ligands or results in a neutral effect during ligand interactions. Consequently, allosteric sites have the ability to disrupt or fully halt the signal transduction process. Moreover, the site remained stable throughout the interaction. As a result, allosteric site targeting can effectively suppress cellular proliferation, particularly in malignant conditions, with allosteric inhibitors showing high selectivity.¹²

Acenocoumarol is an oral anticoagulant primarily used for the prevention and treatment of thromboembolic disorders. It inhibits the synthesis of vitamin K-dependent clotting factors (II, VII, IX, and X) in the liver, which are essential for blood clot formation. This action helps prevent the formation of new blood clots and the growth of existing clots.³⁰ Silodosin is an alpha-1 adrenergic receptor antagonist primarily used for the treatment of benign prostatic hyperplasia (BPH), a condition characterized by an enlarged prostate gland that can cause urinary symptoms in men.³¹ Acenocoumarol is a coumarin derivative with an active chiral core that is present in the enantiomeric form.³² Acenocoumarol is absorbed by the gastrointestinal tract and undergoes first-pass metabolism, which results in peak plasma levels after dosing. In addition, if not administered in lower doses, it may lead to thromboembolic events.³³ A study indicated that acenocoumarol can upregulate extracellular signal-regulated kinase 2 (ERK1/2), leading to the activation of phosphorylation in the TK pathway. Acenocoumarol also affects the PI3K/AkT, MAPK, and RAS pathways by controlling the TK moiety.³⁴

Enzymes ERK2 and KRAS significantly inhibited enzymatic activity upon administration of silodosin. Hence, silodosin inhibits cell proliferation in NSCLC by inhibiting the signal transduction cascade, MAPKs, ERK, and k-RAS, which can stop aggressive growth, leading to potent anti-NSCLC activity. An earlier report showed that silodosin was able to produce pro-apoptotic activity in bladder cancer cells by enhancing the cytotoxic activity of cisplatin via ELK1 inactivation.³⁵ Silodosin is produced by α-androgenic blockers. Silodosin is the treatment of choice for lower urinary tract symptoms (LUTS) and benign prostatic hyperplasia (BPH).³⁶ Signal transduction in the TK complex via phosphorylation at certain sites in response to MAPKs and ERK. ELK-1 activation has been reported to demonstrate pro-apoptotic activity within the cytoplasm and pro-differentiation activity inside the nucleus of cancer cells, which lowers aggressive cell proliferation.³⁷ The degradation products of silodosin also exhibited anticancer activity.³⁸ Hence, silodosin could be repurposed as an anti-NSCLC drug.

Allosteric inhibition of EGFR can prevent the autophosphorylation of tyrosine residues, blocking the recruitment of Grb2 (Growth factor receptor-bound protein 2) and Son of Sevenless (SOS), which are essential for KRAS activation.³⁹ ERK2 is the downstream regulator of KRAS in the RAS-RAF-MEK-ERK pathway; hence, activation depends on upstream signals, such as EGFR.⁴⁰ Hence, allosteric EGFR affects the activation of KRAS, which cascades through RAF and MEK to influence ERK2 phosphorylation. In this study, when enzymes ERK2 and KRAS were examined for their activity following the administration of silodosin, they demonstrated upregulated activity by exhibiting considerable enzymatic inhibition. We can conclude that silodosin and acenocomerol were able to reduce cell proliferation in NSCLC by suppressing the signal transduction cascade, MAPKs, ERK, and KRAS. Silodosin was able to promote pro-apoptotic activity in cancer cells and inhibit aggressive cancer growth, leading to significant anti-NSCLC activity that could be attributed to its allosteric EGFR inhibition.

Conclusion

The in silico study inferred that acenocoumarol and silodosin have an affinity for EGFR allosteric sites. Acenocoumarol and silodosin were subjected to a series of in vitro and A549 xenograft analyses to evaluate their potencies. Both drugs showed significant effects on A549 cells and were able to control the overexpression of ERK2 and KRAS. These drugs can be further explored in clinical trials to determine the efficacy of these drugs as fourth-generation anti-NSCLC agents.

Ethics considerations

The study was approved by the Institute’s Ethical Committee as per IAEC guidelines, and the Arrive Guidelines 2.0 was archived. The ethics approval no. for the study was IAEC-SLS-2022-071 (Date: 25^th October 2022). All studies and animal handling were performed strictly according to the IAEC guidelines, and the ARRIVE 2.0 Checklist was archived.¹³

Author contributions

Swastika Maity: Conceptualization, Data curation, formal analysis, Investigation, Methodology, Project administration, writing the original draft, and editing.

Krishnaprasad Baby: Methodology, Formal analysis, Validation

Bharath Harohalli Byregowda: Methodology, Formal analysis, writing- review and editing

Megh Pravin Vithalkar: Methodology, Formal analysis, Visualization

Usha Y Nayak: Supervision, Validation, Resources

K Sreedhara Ranganath Pai: Supervision, Validation, Conceptualization.

Yogendra Nayak: Conceptualization, formal analysis, methodology, data curation, supervision, funding acquisition, writing, review, and editing.

Data availability

Underlying data archived at Figshare https://doi.org/10.6084/m9.figshare.24587592.v5.¹³

This project contains the following underlying data:

ARRIVE-2.0_checklist.pdf

Supplementary_file-1.docx (Data generated by in silico studies)

Supplementary_file-2.docx (Data generated by in vitro and in vivo studies)

Methods in Detail 1.docx (Detailed materials and methods for in vitro and in vivo studies)

Results.xlsx (Contains the in vitro and in vivo data)

Images- SDS.pptx (Contains the original images of western blots)

Acknowledgement

The authors are thankful to the Manipal Academy of Higher Education, Manipal for the Financial support, and Dr. TMA Pai PhD Fellowship to Krishnaprasad Baby, Bharath Harohalli Byregowda, and Megh Pravin Vithalkar.

References

1. Iyer RS, Needham SR, Galdadas I, et al.: Drug-resistant EGFR mutations promote lung cancer by stabilizing interfaces in ligand-free kinase-active EGFR oligomers. Nat. Commun. 2024; 15(1): 2130. PubMed Abstract | Publisher Full Text | Free Full Text
2. Brown BP, Zhang YK, Kim S, et al.: Allele-specific activation, enzyme kinetics, and inhibitor sensitivities of EGFR exon 19 deletion mutations in lung cancer. Proc. Natl. Acad. Sci. USA. 2022; 119(30): e2206588119. PubMed Abstract | Publisher Full Text | Free Full Text
3. Fassunke J, Müller F, Keul M, et al.: Overcoming EGFR G724S -mediated osimertinib resistance through unique binding characteristics of second-generation EGFR inhibitors. Nat. Commun. 2018; 9(1): 4655. PubMed Abstract | Publisher Full Text | Free Full Text
4. Makinoshima H, Takita M, Saruwatari K, et al.: Signalling through the phosphatidylinositol 3-kinase (PI3K)/mammalian target of rapamycin (mTOR) axis is responsible for aerobic glycolysis mediated by glucose transporter in epidermal growth factor receptor (EGFR)-mutated lung adenocarcinoma. J. Biol. Chem. 2015; 290(28): 17495–17504. PubMed Abstract | Publisher Full Text | Free Full Text
5. Zhou H, Fu H, Liu H, et al.: Uncovering the Mechanism of Drug Resistance Caused by the T790M Mutation in EGFR Kinase From Absolute Binding Free Energy Calculations. Front. Mol. Biosci. 2022; 9: 9. Publisher Full Text
6. Li HS, Wang SZ, Xu HY, et al.: Afatinib and Dacomitinib Efficacy, Safety, Progression Patterns, and Resistance Mechanisms in Patients with Non-Small Cell Lung Cancer Carrying Uncommon EGFR Mutations: A Comparative Cohort Study in China (AFANDA Study). Cancers (Basel). 2022; 14(21). PubMed Abstract | Publisher Full Text | Free Full Text
7. Shaikh M, Shinde Y, Pawara R, et al.: Emerging Approaches to Overcome Acquired Drug Resistance Obstacles to Osimertinib in Non-Small-Cell Lung Cancer. J. Med. Chem. 2022; 65(2): 1008–1046. PubMed Abstract | Publisher Full Text
8. Alam M, Hasan GM, Eldin SM, et al.: Investigating regulated signalling pathways in therapeutic targeting of non-small cell lung carcinoma. Biomed. Pharmacother. 2023; 161(March): 114452. Publisher Full Text
9. Bahar ME, Kim HJ, Kim DR: Targeting the RAS/RAF/MAPK pathway for cancer therapy: from mechanism to clinical studies. Signal Transduct. Target. Ther. 2023; 8(1): 455. PubMed Abstract | Publisher Full Text | Free Full Text
10. Leonetti A, Sharma S, Minari R, et al.: Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br. J. Cancer. 2019; 121(9): 725–737. PubMed Abstract | Publisher Full Text | Free Full Text
11. To C, Beyett TS, Jang J, et al.: An allosteric inhibitor against the therapy-resistant mutant forms of EGFR in non-small cell lung cancer. Nat. Can. 2022; 3(4): 402–417.
12. Maity S, Pai KSR, Nayak Y: Advances in targeting EGFR allosteric site as anti-NSCLC therapy to overcome the drug resistance. Pharmacol. Rep. 2020; 72(4): 799–813. PubMed Abstract | Publisher Full Text | Free Full Text
13. Maity S, Baby K, Bharath HB, et al.: Targeting EGFR Allosteric Site - An In Silico, in vitro and in vivo Drug Repurposing Study for Treating Non-Small Cell Lung Cancer.2024. Publisher Full Text Reference Source
14. Ghasemi M, Turnbull T, Sebastian S, et al.: The mtt assay: Utility, limitations, pitfalls, and interpretation in bulk and single-cell analysis. Int. J. Mol. Sci. 2021; 22(23). PubMed Abstract | Publisher Full Text | Free Full Text
15. Riss TL, Moravec RA, Niles AL, et al.: Cell Viability Assays. Assay Guidance Manual. Bethesda (MD): Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004. 2013 May 1 [updated 2016 Jul 1]; pp: 1–25. Bookshelf ID: NBK144065. PubMed Abstract
16. Lakshmanan I, Batra SK: Protocol for Apoptosis Assay by Flow Cytometry Using Annexin V Staining Method. Bio Protoc. 2013; 3(6): e374. Publisher Full Text
17. Siddiqui S, Livák F: Principles of Advanced Flow Cytometry: A Practical Guide. Methods Mol. Biol. 2023; 2580: 89–114. PubMed Abstract | Publisher Full Text | Free Full Text
18. Li J, Wang R, Hu X, et al.: Activated MEK/ERK Pathway Drives Widespread and Coordinated Overexpression of UHRF1 and DNMT1 in Cancer cells. Sci. Rep. 2019; 9(1): 1–15.
19. Orue A, Rieber M: Optimized multiplex detection of 7 KRAS Mutations by Taqman Allele-SpecificqPCR. PLoS One. 2016; 11(9): 1–13. Publisher Full Text
20. Zhao C, Li Y, Qiu W, et al.: C5a induces A549 cell proliferation of non-small cell lung cancer via GDF15 gene activation mediated by GCN5-dependent KLF5 acetylation. Oncogene. 2018; 37(35): 4821–4837. PubMed Abstract | Publisher Full Text | Free Full Text
21. Ding H, Wang J, Jia FP, et al.: Research on the A549 cell apoptosis mechanism of the nude mouse model using MenSC-sTRAIL. Eur. Rev. Med. Pharmacol. Sci. 2017; 21(14): 3218–3222. PubMed Abstract
22. Zavrakidis I, Jóźwiak K, Hauptmann M: Statistical analysis of longitudinal data on tumour growth in mice experiments. Sci. Rep. 2020; 10(1): 1–11.
23. Ponder KG, Boise LH: The prodomain of caspase-3 regulates its own removal and caspase activation. Cell Death Dis. 2019; 5(1): 1–10.
24. Wiesner R, Scheller C, Krebs F, et al.: A comparative study of CE-SDS, SDS-PAGE, and Simple Western: Influences of sample preparation on molecular weight determination of proteins. Electrophoresis. 2021; 42(3): 206–218. PubMed Abstract | Publisher Full Text
25. Cooper JR, Abdullatif MB, Burnett EC, et al.: Long term culture of the a549 cancer cell line promotes multilamellar body formation and differentiation towards an alveolar type II Pneumocyte phenotype. PLoS One. 2016; 11(10): 1–20. Publisher Full Text
26. O’Leary C, Gasper H, Sahin KB, et al.: Epidermal growth factor receptor (EGFR)-mutated non-small-cell lung cancer (NSCLC). Pharmaceuticals. 2020; 13(10): 1–16. Publisher Full Text
27. To C, Jang J, Chen T, et al.: Single and dual targeting of mutant EGFR with an allosteric inhibitor. Cancer Discov. 2019; 9: 926–943. PubMed Abstract | Publisher Full Text | Free Full Text
28. Wittlinger F, Ogboo BC, Shevchenko E, et al.: Linking ATP and allosteric sites to achieve superadditive binding with bivalent EGFR kinase inhibitors. Commun. Chem. 2024; 7(1): 38. PubMed Abstract | Publisher Full Text | Free Full Text
29. Parums DV: Current status of targeted therapy in non-small cell lung cancer. Drugs Today (Barc.). 2014 Jul; 50(7): 503–525. Publisher Full Text
30. Karthik Rao N, Patil N, Avinash A, et al.: Acenocoumarol or warfarin: Which is the clinician’s ally? Asian J. Pharm. Clin. Res. 2016; 9(2): 4–5.
31. Roehrborn CG, Cruz F, Fusco F: α1-Blockers in Men with Lower Urinary Tract Symptoms Suggestive of Benign Prostatic Obstruction: Is Silodosin Different? Adv. Ther. 2017; 33(12): 2110–2121. PubMed Abstract
32. Kasperkiewicz K, Ponczek MB, Owczarek J, et al.: and New Synthetic and Natural Coumarin Derivatives. Molecules. 2020; 25: 1–24. Publisher Full Text
33. Verhoef TI, Redekop WK, Daly AK, et al.: Pharmacogenetic-guided dosing of coumarin anticoagulants: Algorithms for warfarin, acenocoumarol and phenprocoumon. Br. J. Clin. Pharmacol. 2014; 77(4): 626–641. PubMed Abstract | Publisher Full Text | Free Full Text
34. Han H, Hyun C: Acenocoumarol, an Anticoagulant Drug, Prevents Melanogenesis in B16F10 Melanoma Cells. Pharmaceuticals. 2023; 16(4). PubMed Abstract | Publisher Full Text | Free Full Text
35. Kawahara T, Ide H, Kashiwagi E, et al.: Silodosin inhibits the growth of bladder cancer cells and enhances the cytotoxic activity of cisplatin via ELK1 inactivation. Am. J. Cancer Res. 2015; 5(10): 2959–2968. PubMed Abstract
36. Jindan L, Xiao W, Liping X: Evolving Role of Silodosin for the Treatment of Urological Disorders – A Narrative Review. Drug Des. Devel. Ther. 2022; 16: 2861–2884. PubMed Abstract | Publisher Full Text | Free Full Text
37. Besnard A, Galan-Rodriguez B, Vanhoutte P, et al.: Elk-1 a transcription factor with multiple facets in the brain. Front. Neurosci. 2011; 5: 1–11.
38. Vishnuvardhan C, Saibaba B, Allakonda L, et al.: LC–ESI–MS/MS evaluation of forced degradation behaviour of silodosin: in vitro anti cancer activity evaluation of silodosin and major degradation products. J. Pharm. Biomed. Anal. 2017; 134: 1–10. PubMed Abstract | Publisher Full Text
39. Gupta K, Jones JC, Farias VDA, et al.: Identification of Synergistic Drug Combinations to Target KRAS-Driven Chemoradioresistant Cancers Utilizing Tumoroid Models of Colorectal Adenocarcinoma and Recurrent Glioblastoma. Front. Oncol. 2022; 12. PubMed Abstract | Publisher Full Text | Free Full Text
40. Liang Y, Zhang T, Jing S, et al.: 20(S)-Ginsenoside Rg3 Inhibits Lung Cancer Cell Proliferation by Targeting EGFR-Mediated Ras/Raf/MEK/ERK Pathway. Am. J. Chin. Med. 2021; 49(3): 753–765. PubMed Abstract | Publisher Full Text

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 21 Nov 2024

Author details Author details

¹ Department of Pharmacology, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India
² Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, Manipal Academy of Higher Education, Manipal, Karnataka, 576104, India

Swastika Maity
Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing – Original Draft Preparation

Krishnaprasad Baby
Roles: Formal Analysis, Methodology, Validation

Bharath Harohalli Byregowda
Roles: Formal Analysis, Methodology, Writing – Review & Editing

Megh Pravin Vithalkar
Roles: Formal Analysis, Methodology, Visualization

Usha Y Nayak
Roles: Resources, Supervision, Validation

K Sreedhara Ranganath Pai
Roles: Conceptualization, Supervision, Validation

Yogendra Nayak
Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Methodology, Supervision, Writing – Review & Editing

Competing interests

No competing interests were disclosed.

Grant information

Swastika Maity received an ICMR Senior Research Fellowship (ICMR-SRF #45/33/2019/PHA/BMS). The authors are thankful to the Department of Pharmaceutics, Manipal College of Pharmaceutical Sciences, for facilitating the computer simulations. Schrodinger's Software and Computers were procured under a grant from DST-SERB, New Delhi, to Usha YN (EMR/2016/007006).
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Article Versions (1)

version 1

Published: 21 Nov 2024, 13:1398

https://doi.org/10.12688/f1000research.157465.1

Copyright

© 2024 Maity S et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Download

Export To

metrics

	Views	Downloads
F1000Research	-	-
PubMed Central Data from PMC are received and updated monthly.	-	-

Citations

0

SEE MORE DETAILS

CITE

how to cite this article

Maity S, Baby K, Byregowda BH et al. Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer [version 1; peer review: 1 approved with reservations, 1 not approved]. F1000Research 2024, 13:1398 (https://doi.org/10.12688/f1000research.157465.1)

NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article.

track

receive updates on this article

Track an article to receive email alerts on any updates to this article.

Open Peer Review

Version 1

VERSION 1

PUBLISHED 21 Nov 2024

Views

15

Reviewer Report 03 Jan 2025

Chandan Shivamallu, Department of Biotechnology and Bioinformatics, JSS Academy of Higher Education and Research, Mysuru, India

Approved with Reservations

https://doi.org/10.5256/f1000research.172916.r347134

This manuscript presents an innovative approach to repurpose acenocoumarol and silodosin as allosteric inhibitors targeting EGFR for non-small-cell lung cancer (NSCLC). The combination of computational tools, in vitro analyses, and in vivo xenograft studies offers a vigorous frame for evaluating ... Continue reading

This manuscript presents an innovative approach to repurpose acenocoumarol and silodosin as allosteric inhibitors targeting EGFR for non-small-cell lung cancer (NSCLC). The combination of computational tools, in vitro analyses, and in vivo xenograft studies offers a vigorous frame for evaluating the potential of these drugs in a therapeutic context.
The repurposing of clinically approved drugs as EGFR allosteric inhibitors provides a promising pathway to overcome drug resistance in NSCLC. This approach leverages known safety profiles, accelerating clinical translation. For this, the comprehensive methodology applied such as in silico, in vitro and in vivo is commendable. The molecular docking and dynamic studies are detailed and provide strong evidence of binding affinity for the EGFR allosteric site. Cytotoxicity, apoptosis, cell cycle arrest, and gene expression studies are systematically performed, showcasing the drugs’ mechanisms of action. The inclusion of tumor regression and histopathological analysis strengthens the translational relevance of the findings.
The significant findings include both acenocoumarol and silodosin demonstrated effective inhibition of KRAS and ERK2, key players in EGFR signaling. The observed upregulation of caspase-3 and tumor growth inhibition validates the anti-NSCLC activity of these drugs. Further, the manuscript adheres to ethical guidelines, and all experimental procedures are well-documented, reflecting the integrity of the research.
The findings in this work warrant publishing of this manuscript, however few suggestions for improvement are
1) While the data are extensive, certain figures and tables lack concise labeling and clarity, which could hinder understanding for readers who are unfamiliar with the subject. 2) In the discussion part, readers could benefit from a more detailed comparison with existing EGFR inhibitors, emphasizing the advantages of acenocoumarol and silodosin in terms of efficacy, selectivity, and safety.
3) Although the study concludes with a call for clinical trials, the discussion could elaborate on the specific challenges, such as pharmacokinetics and potential side effects, that need addressing for these drugs.
4) Minor grammatical inconsistencies and redundancies could be refined to enhance the readability and professionalism of the manuscript.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: Microbiology, Cancer Biology, Computational Biology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

CITE

Report a concern

Respond or Comment

Views

28

Reviewer Report 03 Dec 2024

Tyler Beyett, Department of Pharmacology and Chemical Biology, Emory University School of Medicine, Atlanta, USA

Not Approved

https://doi.org/10.5256/f1000research.172916.r343035

In this article, Maity et al. explore the effects of acenocoumarol and silodosin treatment on primarily on A549 cells. They show that high doses of either molecule induce apoptosis in cell culture and have a slight, but significant, effect in ... Continue reading

In this article, Maity et al. explore the effects of acenocoumarol and silodosin treatment on primarily on A549 cells. They show that high doses of either molecule induce apoptosis in cell culture and have a slight, but significant, effect in xenograft models. Overall, I have major concerns about the interpretation of the results. While I believe the data showing that these molecules are cytotoxic, I am not convinced that it is through inhibition of EGFR.

Specific major points:

My biggest concern with this manuscript is the multiple references to these molecules as allosteric EGFR inhibitors. For example, in the manuscript title and the last sentence of the discussion. No data are presented in this study showing inhibition of EGFR by acenocoumarol or silodosin. There are also no data showing that they work through an allosteric mechanism of action. No allosteric inhibition data are provided in the reference prior work (reference 13) either. This reference only describes docking of the molecules and is lacking controls/reference molecules such as known allosteric EGFR inhibitors like EAI045 and JBJ-09-063. Docking is only a prediction that still requires experimental validation (protein-ligand binding analysis, biochemical kinase inhibition assay, cellular inhibition by phospho-EGFR western blot, etc.). Confirming an allosteric mechanism of action requires a crystal structure or enzymatic inhibition assays with varying ATP concentrations. For these reasons, the multiple claims that these molecules are allosteric EGFR inhibitors cannot be made, and this study must be presented/worded differently as a result.
Related to the previous point, since inhibition of EGFR has not been shown, it cannot be assumed that the cytotoxic effects observed are related to EGFR. Performing a target engagement assay would aid in showing the effects are on target rather than working through another mechanism/pathway to induce apoptosis. Many compounds will induce cell death.
Throughout the manuscript, critical details about experimental replicate (n) number are missing. The number of biological and technical replicates must be noted for all experiments. This is especially important since SEM is being reported, which is affected by n.
Throughout the manuscript, relevant controls including known EGFR inhibitors, ATP-competitive and allosteric, are missing. Cisplatin is not the standard of care for the vast majority of EGFR-driven cancers and thus is not an ideal reference compound. As A549 cells are do not express mutant EGFR (they overexpress wild-type EGFR), a pan-EGFR inhibitor like afatinib is an ideal positive control.
In the MTT cytotoxicity assay it is difficult to see where the IC50s are being derived from for some molecules. IC50 is defined as the inflection point of a sigmoidal curve, but many of these curves do not have such a point and do not appear to encompass enough of the dose-response curve to accurately report an IC50. Inclusion of EGFR inhibitors as controls, especially allosteric inhibitors, is needed for a frame of reference since IC50s are condition dependent. Additionally, it is not clear why acenocoumarol and silodosin were chosen. It is claimed that “From the cytotoxicity results, we selected the best drugs, acenocoumarol and silodosin, for further testing.” These molecules were not consistently more potent than the others. What wasn’t danusertib selected? It is most potent against the cancer cell line and least potent against the healthy cell line, which is typically the desired profile of a targeted therapy.
The section titled “KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin” is misleading as no inhibition data are presented. That section only provides data on total protein levels. Furthermore, it appears as if this experiment was only performed once. Given the potential for bias in quantifying western blot bands by densitometry, especially weak bands, this experiment must be performed multiple times and error bars reported.
Related to the previous point, in the discussion it is stated that “Enzymes ERK2 and KRAS significantly inhibited enzymatic activity upon administration of silodosin” and “suppressing the signal transduction cascade.” This and related statements need to be removed, as enzymatic activity and signal transduction of ERK2 (typically assessed by phospho-ERK blotting) or activation of RAS (assaying for GTP bound state or GTPase activity) are not assessed. Furthermore, the use of “significantly” is inappropriate given that no statistical analyses were performed in the relevant figures 7 and 8.
Information on the statistical tests used in Figures 9, 10, and 11 are missing.
The related figures 7 and 8 do not make sense. For example, 12.5 uM silodosin greatly decreases expression, but the protein levels are not dramatically decreased. Similarly, for 25 uM acenocoumarol, expression is decreased for ERK2, but the protein level is normal. In the same group, KRAS expression is comparable to the controls, but protein levels are greatly increased. What is the explanation for this disconnect?
In figure 9, are statistical tests only performed for the last treatment point (day 21)? If so, this must be stated. Other time points are likely significant if also considered. In the figure legend, I hope that p<0.5 is a typo meant to be p<0.05. The former significance cutoff is not stringent enough.
In figure 11, what are the statistical significances for? And what statistical test was employed? Are you saying that all of the organs from a treatment group are significantly different than their corresponding values in the vehicle group? What about comparisons between treatment groups? Such analyses may require a multiple comparisons post hoc correction be used in the statistical analysis.
Numerous typos throughout including, but not limited to, T750M and L858M (page 3). There are also red underlines in the text for figure 14 that should be removed.
Antibodies used in western blots must be noted with their source and catalog number since they can vary widely.
Source data should include the individual replicates for each experiment in addition to just the mean ± SEM

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

No

Competing Interests: No competing interests were disclosed.

Reviewer Expertise: EGFR pharmacology including allosteric inhibitor discovery and development

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

CITE

Report a concern

Respond or Comment

Comments on this article Comments (0)

Version 1

VERSION 1 PUBLISHED 21 Nov 2024

Open Peer Review

Reviewer Status

Reviewer Reports

	Invited Reviewers
	1	2
Version 1 21 Nov 24	read	read

Tyler Beyett, Emory University School of Medicine, Atlanta, USA
Chandan Shivamallu, JSS Academy of Higher Education and Research, Mysuru, India

Comments on this article

All Comments(0)

Add a comment

Sign up for content alerts

Browse by related subjects

Back to all reports

Reviewer Report

15 Views

03 Jan 2025 | for Version 1

Chandan Shivamallu, Department of Biotechnology and Bioinformatics, JSS Academy of Higher Education and Research, Mysuru, India

15 Views Cite this report Responses(0)

Approved With Reservations

This manuscript presents an innovative approach to repurpose acenocoumarol and silodosin as allosteric inhibitors targeting EGFR for non-small-cell lung cancer (NSCLC). The combination of computational tools, in vitro analyses, and in vivo xenograft studies offers a vigorous frame for evaluating the potential of these drugs in a therapeutic context.
The repurposing of clinically approved drugs as EGFR allosteric inhibitors provides a promising pathway to overcome drug resistance in NSCLC. This approach leverages known safety profiles, accelerating clinical translation. For this, the comprehensive methodology applied such as in silico, in vitro and in vivo is commendable. The molecular docking and dynamic studies are detailed and provide strong evidence of binding affinity for the EGFR allosteric site. Cytotoxicity, apoptosis, cell cycle arrest, and gene expression studies are systematically performed, showcasing the drugs’ mechanisms of action. The inclusion of tumor regression and histopathological analysis strengthens the translational relevance of the findings.
The significant findings include both acenocoumarol and silodosin demonstrated effective inhibition of KRAS and ERK2, key players in EGFR signaling. The observed upregulation of caspase-3 and tumor growth inhibition validates the anti-NSCLC activity of these drugs. Further, the manuscript adheres to ethical guidelines, and all experimental procedures are well-documented, reflecting the integrity of the research.
The findings in this work warrant publishing of this manuscript, however few suggestions for improvement are
1) While the data are extensive, certain figures and tables lack concise labeling and clarity, which could hinder understanding for readers who are unfamiliar with the subject. 2) In the discussion part, readers could benefit from a more detailed comparison with existing EGFR inhibitors, emphasizing the advantages of acenocoumarol and silodosin in terms of efficacy, selectivity, and safety.
3) Although the study concludes with a call for clinical trials, the discussion could elaborate on the specific challenges, such as pharmacokinetics and potential side effects, that need addressing for these drugs.
4) Minor grammatical inconsistencies and redundancies could be refined to enhance the readability and professionalism of the manuscript.

Is the work clearly and accurately presented and does it cite the current literature?

Yes
Is the study design appropriate and is the work technically sound?

Yes
Are sufficient details of methods and analysis provided to allow replication by others?

Yes
If applicable, is the statistical analysis and its interpretation appropriate?

Yes
Are all the source data underlying the results available to ensure full reproducibility?

Yes
Are the conclusions drawn adequately supported by the results?

Yes

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

Microbiology, Cancer Biology, Computational Biology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Respond to this report

Responses (0)

Back to all reports

Reviewer Report

28 Views

03 Dec 2024 | for Version 1

Tyler Beyett, Department of Pharmacology and Chemical Biology, Emory University School of Medicine, Atlanta, USA

28 Views Cite this report Responses(0)

Not Approved

In this article, Maity et al. explore the effects of acenocoumarol and silodosin treatment on primarily on A549 cells. They show that high doses of either molecule induce apoptosis in cell culture and have a slight, but significant, effect in xenograft models. Overall, I have major concerns about the interpretation of the results. While I believe the data showing that these molecules are cytotoxic, I am not convinced that it is through inhibition of EGFR.

Specific major points:

My biggest concern with this manuscript is the multiple references to these molecules as allosteric EGFR inhibitors. For example, in the manuscript title and the last sentence of the discussion. No data are presented in this study showing inhibition of EGFR by acenocoumarol or silodosin. There are also no data showing that they work through an allosteric mechanism of action. No allosteric inhibition data are provided in the reference prior work (reference 13) either. This reference only describes docking of the molecules and is lacking controls/reference molecules such as known allosteric EGFR inhibitors like EAI045 and JBJ-09-063. Docking is only a prediction that still requires experimental validation (protein-ligand binding analysis, biochemical kinase inhibition assay, cellular inhibition by phospho-EGFR western blot, etc.). Confirming an allosteric mechanism of action requires a crystal structure or enzymatic inhibition assays with varying ATP concentrations. For these reasons, the multiple claims that these molecules are allosteric EGFR inhibitors cannot be made, and this study must be presented/worded differently as a result.
Related to the previous point, since inhibition of EGFR has not been shown, it cannot be assumed that the cytotoxic effects observed are related to EGFR. Performing a target engagement assay would aid in showing the effects are on target rather than working through another mechanism/pathway to induce apoptosis. Many compounds will induce cell death.
Throughout the manuscript, critical details about experimental replicate (n) number are missing. The number of biological and technical replicates must be noted for all experiments. This is especially important since SEM is being reported, which is affected by n.
Throughout the manuscript, relevant controls including known EGFR inhibitors, ATP-competitive and allosteric, are missing. Cisplatin is not the standard of care for the vast majority of EGFR-driven cancers and thus is not an ideal reference compound. As A549 cells are do not express mutant EGFR (they overexpress wild-type EGFR), a pan-EGFR inhibitor like afatinib is an ideal positive control.
In the MTT cytotoxicity assay it is difficult to see where the IC50s are being derived from for some molecules. IC50 is defined as the inflection point of a sigmoidal curve, but many of these curves do not have such a point and do not appear to encompass enough of the dose-response curve to accurately report an IC50. Inclusion of EGFR inhibitors as controls, especially allosteric inhibitors, is needed for a frame of reference since IC50s are condition dependent. Additionally, it is not clear why acenocoumarol and silodosin were chosen. It is claimed that “From the cytotoxicity results, we selected the best drugs, acenocoumarol and silodosin, for further testing.” These molecules were not consistently more potent than the others. What wasn’t danusertib selected? It is most potent against the cancer cell line and least potent against the healthy cell line, which is typically the desired profile of a targeted therapy.
The section titled “KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin” is misleading as no inhibition data are presented. That section only provides data on total protein levels. Furthermore, it appears as if this experiment was only performed once. Given the potential for bias in quantifying western blot bands by densitometry, especially weak bands, this experiment must be performed multiple times and error bars reported.
Related to the previous point, in the discussion it is stated that “Enzymes ERK2 and KRAS significantly inhibited enzymatic activity upon administration of silodosin” and “suppressing the signal transduction cascade.” This and related statements need to be removed, as enzymatic activity and signal transduction of ERK2 (typically assessed by phospho-ERK blotting) or activation of RAS (assaying for GTP bound state or GTPase activity) are not assessed. Furthermore, the use of “significantly” is inappropriate given that no statistical analyses were performed in the relevant figures 7 and 8.
Information on the statistical tests used in Figures 9, 10, and 11 are missing.
The related figures 7 and 8 do not make sense. For example, 12.5 uM silodosin greatly decreases expression, but the protein levels are not dramatically decreased. Similarly, for 25 uM acenocoumarol, expression is decreased for ERK2, but the protein level is normal. In the same group, KRAS expression is comparable to the controls, but protein levels are greatly increased. What is the explanation for this disconnect?
In figure 9, are statistical tests only performed for the last treatment point (day 21)? If so, this must be stated. Other time points are likely significant if also considered. In the figure legend, I hope that p<0.5 is a typo meant to be p<0.05. The former significance cutoff is not stringent enough.
In figure 11, what are the statistical significances for? And what statistical test was employed? Are you saying that all of the organs from a treatment group are significantly different than their corresponding values in the vehicle group? What about comparisons between treatment groups? Such analyses may require a multiple comparisons post hoc correction be used in the statistical analysis.
Numerous typos throughout including, but not limited to, T750M and L858M (page 3). There are also red underlines in the text for figure 14 that should be removed.
Antibodies used in western blots must be noted with their source and catalog number since they can vary widely.
Source data should include the individual replicates for each experiment in addition to just the mean ± SEM

Is the work clearly and accurately presented and does it cite the current literature?

Partly
Is the study design appropriate and is the work technically sound?

No
Are sufficient details of methods and analysis provided to allow replication by others?

Partly
If applicable, is the statistical analysis and its interpretation appropriate?

No
Are all the source data underlying the results available to ensure full reproducibility?

Partly
Are the conclusions drawn adequately supported by the results?

No

Competing Interests

No competing interests were disclosed.

Reviewer Expertise

EGFR pharmacology including allosteric inhibitor discovery and development

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

Respond to this report

Responses (0)

[1] 1. Iyer RS, Needham SR, Galdadas I, et al.: Drug-resistant EGFR mutations promote lung cancer by stabilizing interfaces in ligand-free kinase-active EGFR oligomers. Nat. Commun. 2024; 15(1): 2130. PubMed Abstract | Publisher Full Text | Free Full Text

[2] 2. Brown BP, Zhang YK, Kim S, et al.: Allele-specific activation, enzyme kinetics, and inhibitor sensitivities of EGFR exon 19 deletion mutations in lung cancer. Proc. Natl. Acad. Sci. USA. 2022; 119(30): e2206588119. PubMed Abstract | Publisher Full Text | Free Full Text

[3] 3. Fassunke J, Müller F, Keul M, et al.: Overcoming EGFR G724S -mediated osimertinib resistance through unique binding characteristics of second-generation EGFR inhibitors. Nat. Commun. 2018; 9(1): 4655. PubMed Abstract | Publisher Full Text | Free Full Text

[4] 4. Makinoshima H, Takita M, Saruwatari K, et al.: Signalling through the phosphatidylinositol 3-kinase (PI3K)/mammalian target of rapamycin (mTOR) axis is responsible for aerobic glycolysis mediated by glucose transporter in epidermal growth factor receptor (EGFR)-mutated lung adenocarcinoma. J. Biol. Chem. 2015; 290(28): 17495–17504. PubMed Abstract | Publisher Full Text | Free Full Text

[5] 5. Zhou H, Fu H, Liu H, et al.: Uncovering the Mechanism of Drug Resistance Caused by the T790M Mutation in EGFR Kinase From Absolute Binding Free Energy Calculations. Front. Mol. Biosci. 2022; 9: 9. Publisher Full Text

[6] 6. Li HS, Wang SZ, Xu HY, et al.: Afatinib and Dacomitinib Efficacy, Safety, Progression Patterns, and Resistance Mechanisms in Patients with Non-Small Cell Lung Cancer Carrying Uncommon EGFR Mutations: A Comparative Cohort Study in China (AFANDA Study). Cancers (Basel). 2022; 14(21). PubMed Abstract | Publisher Full Text | Free Full Text

[7] 7. Shaikh M, Shinde Y, Pawara R, et al.: Emerging Approaches to Overcome Acquired Drug Resistance Obstacles to Osimertinib in Non-Small-Cell Lung Cancer. J. Med. Chem. 2022; 65(2): 1008–1046. PubMed Abstract | Publisher Full Text

[8] 8. Alam M, Hasan GM, Eldin SM, et al.: Investigating regulated signalling pathways in therapeutic targeting of non-small cell lung carcinoma. Biomed. Pharmacother. 2023; 161(March): 114452. Publisher Full Text

[9] 9. Bahar ME, Kim HJ, Kim DR: Targeting the RAS/RAF/MAPK pathway for cancer therapy: from mechanism to clinical studies. Signal Transduct. Target. Ther. 2023; 8(1): 455. PubMed Abstract | Publisher Full Text | Free Full Text

[10] 10. Leonetti A, Sharma S, Minari R, et al.: Resistance mechanisms to osimertinib in EGFR-mutated non-small cell lung cancer. Br. J. Cancer. 2019; 121(9): 725–737. PubMed Abstract | Publisher Full Text | Free Full Text

[11] 11. To C, Beyett TS, Jang J, et al.: An allosteric inhibitor against the therapy-resistant mutant forms of EGFR in non-small cell lung cancer. Nat. Can. 2022; 3(4): 402–417.

[12] 12. Maity S, Pai KSR, Nayak Y: Advances in targeting EGFR allosteric site as anti-NSCLC therapy to overcome the drug resistance. Pharmacol. Rep. 2020; 72(4): 799–813. PubMed Abstract | Publisher Full Text | Free Full Text

[13] 13. Maity S, Baby K, Bharath HB, et al.: Targeting EGFR Allosteric Site - An In Silico, in vitro and in vivo Drug Repurposing Study for Treating Non-Small Cell Lung Cancer.2024. Publisher Full Text Reference Source

[14] 14. Ghasemi M, Turnbull T, Sebastian S, et al.: The mtt assay: Utility, limitations, pitfalls, and interpretation in bulk and single-cell analysis. Int. J. Mol. Sci. 2021; 22(23). PubMed Abstract | Publisher Full Text | Free Full Text

[15] 15. Riss TL, Moravec RA, Niles AL, et al.: Cell Viability Assays. Assay Guidance Manual. Bethesda (MD): Eli Lilly & Company and the National Center for Advancing Translational Sciences; 2004. 2013 May 1 [updated 2016 Jul 1]; pp: 1–25. Bookshelf ID: NBK144065. PubMed Abstract

[16] 16. Lakshmanan I, Batra SK: Protocol for Apoptosis Assay by Flow Cytometry Using Annexin V Staining Method. Bio Protoc. 2013; 3(6): e374. Publisher Full Text

[17] 17. Siddiqui S, Livák F: Principles of Advanced Flow Cytometry: A Practical Guide. Methods Mol. Biol. 2023; 2580: 89–114. PubMed Abstract | Publisher Full Text | Free Full Text

[18] 18. Li J, Wang R, Hu X, et al.: Activated MEK/ERK Pathway Drives Widespread and Coordinated Overexpression of UHRF1 and DNMT1 in Cancer cells. Sci. Rep. 2019; 9(1): 1–15.

[19] 19. Orue A, Rieber M: Optimized multiplex detection of 7 KRAS Mutations by Taqman Allele-SpecificqPCR. PLoS One. 2016; 11(9): 1–13. Publisher Full Text

[20] 20. Zhao C, Li Y, Qiu W, et al.: C5a induces A549 cell proliferation of non-small cell lung cancer via GDF15 gene activation mediated by GCN5-dependent KLF5 acetylation. Oncogene. 2018; 37(35): 4821–4837. PubMed Abstract | Publisher Full Text | Free Full Text

[21] 21. Ding H, Wang J, Jia FP, et al.: Research on the A549 cell apoptosis mechanism of the nude mouse model using MenSC-sTRAIL. Eur. Rev. Med. Pharmacol. Sci. 2017; 21(14): 3218–3222. PubMed Abstract

[22] 22. Zavrakidis I, Jóźwiak K, Hauptmann M: Statistical analysis of longitudinal data on tumour growth in mice experiments. Sci. Rep. 2020; 10(1): 1–11.

[23] 23. Ponder KG, Boise LH: The prodomain of caspase-3 regulates its own removal and caspase activation. Cell Death Dis. 2019; 5(1): 1–10.

[24] 24. Wiesner R, Scheller C, Krebs F, et al.: A comparative study of CE-SDS, SDS-PAGE, and Simple Western: Influences of sample preparation on molecular weight determination of proteins. Electrophoresis. 2021; 42(3): 206–218. PubMed Abstract | Publisher Full Text

[25] 25. Cooper JR, Abdullatif MB, Burnett EC, et al.: Long term culture of the a549 cancer cell line promotes multilamellar body formation and differentiation towards an alveolar type II Pneumocyte phenotype. PLoS One. 2016; 11(10): 1–20. Publisher Full Text

[26] 26. O’Leary C, Gasper H, Sahin KB, et al.: Epidermal growth factor receptor (EGFR)-mutated non-small-cell lung cancer (NSCLC). Pharmaceuticals. 2020; 13(10): 1–16. Publisher Full Text

[27] 27. To C, Jang J, Chen T, et al.: Single and dual targeting of mutant EGFR with an allosteric inhibitor. Cancer Discov. 2019; 9: 926–943. PubMed Abstract | Publisher Full Text | Free Full Text

[28] 28. Wittlinger F, Ogboo BC, Shevchenko E, et al.: Linking ATP and allosteric sites to achieve superadditive binding with bivalent EGFR kinase inhibitors. Commun. Chem. 2024; 7(1): 38. PubMed Abstract | Publisher Full Text | Free Full Text

[29] 29. Parums DV: Current status of targeted therapy in non-small cell lung cancer. Drugs Today (Barc.). 2014 Jul; 50(7): 503–525. Publisher Full Text

[30] 30. Karthik Rao N, Patil N, Avinash A, et al.: Acenocoumarol or warfarin: Which is the clinician’s ally? Asian J. Pharm. Clin. Res. 2016; 9(2): 4–5.

[31] 31. Roehrborn CG, Cruz F, Fusco F: α1-Blockers in Men with Lower Urinary Tract Symptoms Suggestive of Benign Prostatic Obstruction: Is Silodosin Different? Adv. Ther. 2017; 33(12): 2110–2121. PubMed Abstract

[32] 32. Kasperkiewicz K, Ponczek MB, Owczarek J, et al.: and New Synthetic and Natural Coumarin Derivatives. Molecules. 2020; 25: 1–24. Publisher Full Text

[33] 33. Verhoef TI, Redekop WK, Daly AK, et al.: Pharmacogenetic-guided dosing of coumarin anticoagulants: Algorithms for warfarin, acenocoumarol and phenprocoumon. Br. J. Clin. Pharmacol. 2014; 77(4): 626–641. PubMed Abstract | Publisher Full Text | Free Full Text

[34] 34. Han H, Hyun C: Acenocoumarol, an Anticoagulant Drug, Prevents Melanogenesis in B16F10 Melanoma Cells. Pharmaceuticals. 2023; 16(4). PubMed Abstract | Publisher Full Text | Free Full Text

[35] 35. Kawahara T, Ide H, Kashiwagi E, et al.: Silodosin inhibits the growth of bladder cancer cells and enhances the cytotoxic activity of cisplatin via ELK1 inactivation. Am. J. Cancer Res. 2015; 5(10): 2959–2968. PubMed Abstract

[36] 36. Jindan L, Xiao W, Liping X: Evolving Role of Silodosin for the Treatment of Urological Disorders – A Narrative Review. Drug Des. Devel. Ther. 2022; 16: 2861–2884. PubMed Abstract | Publisher Full Text | Free Full Text

[37] 37. Besnard A, Galan-Rodriguez B, Vanhoutte P, et al.: Elk-1 a transcription factor with multiple facets in the brain. Front. Neurosci. 2011; 5: 1–11.

[38] 38. Vishnuvardhan C, Saibaba B, Allakonda L, et al.: LC–ESI–MS/MS evaluation of forced degradation behaviour of silodosin: in vitro anti cancer activity evaluation of silodosin and major degradation products. J. Pharm. Biomed. Anal. 2017; 134: 1–10. PubMed Abstract | Publisher Full Text

[39] 39. Gupta K, Jones JC, Farias VDA, et al.: Identification of Synergistic Drug Combinations to Target KRAS-Driven Chemoradioresistant Cancers Utilizing Tumoroid Models of Colorectal Adenocarcinoma and Recurrent Glioblastoma. Front. Oncol. 2022; 12. PubMed Abstract | Publisher Full Text | Free Full Text

[40] 40. Liang Y, Zhang T, Jing S, et al.: 20(S)-Ginsenoside Rg3 Inhibits Lung Cancer Cell Proliferation by Targeting EGFR-Mediated Ras/Raf/MEK/ERK Pathway. Am. J. Chin. Med. 2021; 49(3): 753–765. PubMed Abstract | Publisher Full Text

Exploring acenocoumarol and silodosin as allosteric EGFR inhibitors for the treatment of non-small cell lung cancer

Abstract

Background

Methods

Results

Conclusion

Keywords

Introduction

Methods

Cell culture and maintenance

Cytotoxicity assay using MTT reagent

Apoptosis assay using propidium iodide (PI) and Annexin V-FITC staining

Cell cycle analysis

Western blot quantification KRAS and ERK2

KRAS and ERK2 gene regulation by qPCR

Table 1. Primer details for KRAS and ERK2 fold regulation in A549 cells.

Tumor regression in A549-Xenograft mouse model

qPCR analysis of caspase-3 regulation in the Xenograft

Table 2. The primer sequence for gene regulation of Caspase-3 in A549 xenograft tissue.

Western blot for KARS and ERK2 in the Xenograft

Histopathology of the Xenograft

Results

Cytotoxicity assay

Figure 1. Cytotoxicity of top molecules by MTT assay using A549 cells.

Figure 2. Cytotoxicity of top molecules by MTT assay using IMR-90 cells.

Apoptosis in A549 cells by acenocoumarol and silodosin

Figure 3. Flow cytometry plots for apoptosis detection in A549 cells.

Figure 4. FACS analysis of apoptosis detection in A549 cells.

Effects of acenocoumarol and silodosin on A549 cell cycle

Figure 5. Flow cytometry plots for cell cycle analysis in A549 cells.

Figure 6. FACS analysis of Cell cycle arrest in A549 cells.

KRAS and ERK2 enzymatic inhibition by acenocoumarol and silodosin

Figure 7. Western blot analysis of GAPDH, ERK2 and KRAS in A549 cells.

KRAS and ERK2 gene regulation by acenocoumarol and silodosin

Figure 8. Relative expression by fold change analysis of KRAS and ERK2 gene in A549 cells.

Figure 9. The tumour growth in A549 xenograft tumour model.

Tumor regression efficacy in A549 xenograft by acenocoumarol and silodosin

Figure 10. Percentage of tumour growth inhibition in the A549 xenograft tumour model.

Figure 11. Organ weights of the mice with A549 xenograft tumour.

Caspase-3 regulation in A549 Xenograft

Figure 12. Relative expression of caspase-3 gene in xenograft tumour tissue.

KRAS and ERK2 enzyme inhibition by acenocoumarol and silodosin

Figure 13. Expression analysis of GAPDH, KRAS and ERK2 in xenograft tumor model.

Histopathology analysis of Xenograft tissue

Figure 14. Histopathology analysis of organs obtained from xenograft model.

Discussion

Conclusion

Ethics considerations

Author contributions

Data availability

Acknowledgement

References

Comments on this article Comments (0)

Open Peer Review

Comments on this article Comments (0)

Open Peer Review

Reviewer Status

Reviewer Reports

Comments on this article

Browse by related subjects

Competing Interests Policy

Stay Updated